Можно ли при тонзиллите полоскать горло перекисью водорода: Полоскание горла перекисью водорода при тонзиллите

Способы полоскания горла перекисью водорода при ангине

Полоскание горла перекисью водорода при ангине — эффективный способ дезинфекции и обезболивания воспаленной ротоглотки.

Полоскать горло следует всегда, так как за счет полоскания увлажняется воспаленная слизистая, уменьшаются болевые ощущения. Нужно готовить антисептические растворы с морской солью, с содой, с перекисью водорода. Также травы обладают противомикробным действием. Настоями можно ополаскивать ротоглотку. Такие растворы для полоскания обладают противомикробным, антисептическим действием, способствуют заживлению ранок и язвочек.

Когда рекомендуется использовать

Больное горло следует промывать как можно чаще, особенно при гнойной ангине. На миндалинах образуется белый налет, который самостоятельно не пройдет. Температура может долго держаться из-за гноя. Антибиотики не всегда ее сбивают. Поэтому его следует тщательно смывать. Тогда процесс выздоровления пойдет быстрее, температура будет снижаться, ранки затягиваться. Эффективное средство для вымывания гноя — пероксид.

При попадании на слизистые оболочки или раны пероксид вступает в реакцию, начинает высвобождаться активный кислород. Она пенится, благодаря этой активной пене происходит очищение от белковых соединений, гноя, крови.

Лечение ангины перекисью водорода происходит быстрее и качественнее. Тогда она не переходит в хроническую форму, не дает осложнений на организм.

Применение раствора перекиси водорода очень распространено в лор-практике. Лечат перекисью такие болезни горла: ангина, тонзиллит, ларингит, фарингит; назначают при инфекциях ротовой полости, десен: стоматите и пародонтозе; воспалениях среднего уха, заболеваниях носовых пазух. Перекись водорода при ангине (особенно гнойной) — самый действенный метод.

Пероксид оказывает противомикробный, противовирусный, противогрибковый эффект. Лечиться можно беременным, кормящим, детям. Строго соблюдать дозировку.

Противопоказания к применению перекиси водорода и побочные эффекты

Противопоказаний к применению перекиси водорода практически нет. При индивидуальной непереносимости невозможно применение, так как может возникнуть аллергическая реакция или другой побочный эффект. Стоит четко соблюдать дозировки, кратность приема. Тогда она будет уникальным действующим средством. Нельзя ее применять для внутреннего употребления. С осторожностью детям.

Иногда могут проявляться побочные эффекты, такие как насморк, кашель, усталость, сонливость, в редких случаях понос.

Способы приема

Врач подскажет, как полоскать горло перекисью водорода, подберет правильную дозировку в соответствии с возрастом и степенью болезни.

Для полоскания разводят 1 ст. л. 3% перекиси водорода в стакане теплой воды. Вода, растворы или настои для полосканий должны быть обязательно теплыми, температуры тела. Так достигается лучший терапевтический эффект. Полоскания проводить не более 5 раз в сутки с интервалом не менее 3 часов. Можно чередовать с другими средствами для полосканий. Разница должна составлять не менее 30 минут. Нужно строго соблюдать дозировку и концентрацию раствора. Полоскать горло нужно около 3 минут. Стараться глубже опускать раствор в горло, чтобы он омывал гланды, язычок, заднюю стенку, корень языка. Лекарство нужно набрать в рот, запрокинуть голову назад, произносить непрерывно слово «глу-уу-уу-уу». После полоскания раствор сплевывают, не глотают! Затем нужно горло омыть любым другим антисептическим раствором, чтобы смыть остатки перекиси и усилить эффект от полоскания. Это могут быть травяные настои: ромашковый, календулы, эвкалипта; раствор морской соли, марганца, соды. Всякий следующий раз раствор должен быть разный.

После полного исчезновения налета можно пероксид больше не применять. Горло полоскать другими средствами, травяными настоями. Пероксид водорода существует в форме не только раствора, но и таблеток (Гидроперит). Из него тоже делают раствор для полоскания и промывания. Одну таблетку растворяют в стакане теплой воды.

Лечить горло можно не только с помощью полосканий перекисью. Сделав более концентрированный раствор, его наносят ватным тампоном на миндалины. В 100 мл теплой воды растворить 3 столовые ложки перекиси. Полученным раствором смазывают миндалины с помощью ватных палочек. Ложкой давят на корень языка, чтобы было видно гланды. Длинной палочкой или шпателем, на который намотан смоченный раствором ватный тампон, быстро смазывают миндалины, снимают гной, до появления позывов к рвоте. Затем смывают водой или солевым раствором.

Лечение перекисью по Неумывакину

Неумывакин Иван Павлович

Профессор Неумывакин Иван Павлович утверждает, что лечение пероксидом улучшает самочувствие и избавляет практически от всех болезней, что нужно не только наружное применение перекиси, но и внутренний прием раствора для лучшего эффекта. Схема лечения перекисью водорода по Неумывакину очень проста.

Полоскания по Неумывакину при любых болезненных явлениях в горле, ротовой полости производят раствором, приготовленным из 1–3 ч. л. пероксида на 50 мл воды.

В любом случае должна быть произведена консультация с врачом, особенно если речь идет о заболевшем ребенке. Самолечением заниматься не стоит. Нужна квалифицированная помощь, уместное назначение лекарственных препаратов. Должны быть проведены качественные анализы.


На сайте размещены исключительно оригинальные и авторские статьи.
При копировании разместите ссылку на первоисточник — страницу статьи или главную.

Полоскание горла перекисью водорода при ангине: можно или нет, пропорции

Содержание статьи:

Полоскание горла перекисью водорода при ангине – можно ли полоскать горло и помогает ли данный метод? На этот счет мнения врачей разделились: некоторые считают средство эффективным, в то время как другие не видят смысла в такой процедуре. Рассмотрим этот вопрос поподробнее.

Перекись водорода часто применяется в составе комплексного лечения ангиныПерекись водорода часто применяется в составе комплексного лечения ангины

Перекись водорода, или пероксид водорода – это лекарственный препарат, который относится к группе антисептических и дезинфицирующих средств. Он представляет собой прозрачную бесцветную жидкость, которая при контакте с поврежденными слизистыми оболочками или кожей высвобождает активный кислород. Он, в свою очередь, производит механическое очищение и выводит наружу гной и кровь.

Перекись водорода не является стерилизующим средством, вещество временно уменьшает количество болезнетворных организмов в ране. Образование большого количества пены помогает сформироваться тромбам и остановить кровотечение из мелких сосудов.

Перекись водорода выпускают в виде 3% раствора по 40, 50, 100 и 200 мл во флаконах из темного стекла или пластика. Также в аптеке можно приобрести средство в виде таблеток для приготовления раствора для наружного применения под названием Гидроперит.

Как действует перекись водорода при ангине

В большинстве случаев раствор перекиси водорода используют при гнойной ангине, когда нужно устранить налет с поверхности миндалин.

Чтобы приготовить раствор, в стакан с теплой кипяченой водой добавляют одну столовую ложку средства. Процедуру следует повторять трижды в сутки до тех пор, пока симптомы заболевания не исчезнут.

В процессе борьбы с патогенными микроорганизмами – возбудителями тонзиллита, в лакунах скапливаются микробы, продукты их разложения, лейкоциты, слущенный эпителий, слизь и белковые массы, из которых образуется гной.

Изначально он выглядит как налет желто-белого цвета. В дальнейшем он может уплотняться, приобретая вид пленок, которые легко снимаются шпателем. В устьях лакун могут образовываться казеозные пробки, состав которых идентичный составу гноя.

При попадании перекиси водорода на эти участки происходит высвобождение активного кислорода, в результате чего болезнетворные микроорганизмы вымываются, а поверхность миндалин очищается.

Как разводить и применять раствор

Как полоскать горло перекисью водорода при ангине взрослым и детям? Чтобы приготовить раствор, в стакан с теплой кипяченой водой добавляют одну столовую ложку средства. Процедуру следует повторять трижды в сутки до тех пор, пока симптомы заболевания не исчезнут.

Для приготовления средства на основе Гидроперита, одну таблетку растворяют в 200 мл теплой воды. Применяют по такой же схеме, до достижения эффекта.

Раствор готовят непосредственно перед проведением процедуры, так как он быстро теряет свои свойства. В рот набирают около 15 мл средства, наклоняют голову назад так, чтобы раствор максимально проник в горло, и в течение 3–5 секунд произносят звук «ы». Затем его сплевывают и обработку горла повторяют.

При полоскании горла слабым раствором перекись водорода не всасывается в системный кровоток, поэтому его можно применять в период беременности и лактации.

Нельзя проглатывать средство, так как это может негативно отразиться на состоянии желудочно-кишечного тракта.

Читайте также:

8 напитков, полезных при простуде

15 заболеваний, при которых помогают аппликации с поваренной солью

8 полезных свойств граната

Полоскание горла перекисью водорода по Неумывакину

Доктор медицинских наук Иван Неумывакин, создатель уникальной системы оздоровления, рекомендует использовать перекись водорода как для лечения гнойной, так и хронической ангины. Он говорит о том, что это средство помогает бороться с вирусами, бактериями и грибами, а также стимулирует иммунитет.

Перекись водорода, согласно И. Неумывакину, активна в отношении вирусов и бактерийПерекись водорода, согласно И. Неумывакину, активна в отношении вирусов и бактерий

По его мнению, полоскание горла перекисью водорода помогает быстро избавиться от заболевания, а также предотвратить развитие рецидивов при хроническом тонзиллите. Для того чтобы приготовить раствор для полоскания горла по Неумывакину, в 100 мл теплой воды необходимо растворить одну столовую ложку средства.

Также можно использовать Гидроперит: одну таблетку растворяют в 150 мл теплой кипяченой воды. Полоскание проводят каждые 3 часа, не более 5 раз в сутки.

После окончания процедуры необходимо промыть полость рта и миндалины. Для этого можно использовать теплую кипяченую воду, щелочную минеральную воду (например, Боржоми) или настои лекарственных трав – ромашки, шалфея, календулы. Их готовят, предварительно заливая небольшое количество сырья кипятком, настаивая 40 минут и процеживая. Такое дополнение к основному полосканию даст возможность организму быстрее справиться с инфекцией, повысит местный иммунитет и быстро устранит воспаление.

После окончания процедуры полость рта следует промыть настоем лекарственных трав, например календулыПосле окончания процедуры полость рта следует промыть настоем лекарственных трав, например календулы

Известный педиатр Комаровский говорит о том, что в полоскании горла перекисью водорода нет ничего не научного, и если доктор назначил это средство, то его рекомендации необходимо выполнять. В то же время он считает, что особого эффекта от применения лекарства не будет, поэтому лучше использовать более современные и эффективные препараты.

Противопоказания, побочные эффекты, особенности применения

Применять перекись водорода можно детям, возраст которых не менее 5 лет.

Не рекомендуется использовать средство для полоскания горла при повышенной чувствительности к нему.

Нужно соблюдать пропорции при приготовлении раствора, поскольку слишком высокая концентрация вещества может стать причиной ожога слизистой оболочки ротоглотки.

При полоскании горла слабым раствором перекись водорода не всасывается в системный кровоток, поэтому его можно применять в период беременности и лактации.

Средство не оказывает влияние на скорость реакции, терапия не противопоказана людям, для которых важна скорость реакции.

Перекись водорода не является стерилизующим средством, вещество временно уменьшает количество болезнетворных организмов в ране.

Для приготовления раствора не следует использовать металлическую посуду, так как это может привести к его нестабильности. Для того чтобы перекись водорода не потеряла своих свойств, ее нужно хранить в прохладном темном месте.

По отзывам пациентов, лечение ангины перекисью водорода – достаточно эффективный метод, который помогает очистить миндалины от гноя, тем самым способствуя выздоровлению. Многие пишут о том, что облегчение наступает после 2–3 дней применения, гнойный налет постепенно исчезает, а симптомы болезни отступают.

Необходимо помнить о том, что ангина – достаточно серьезное заболевание, которое может вызвать грозные осложнения, поэтому ее лечение должно быть комплексным. Перед началом терапии необходимо обратиться за консультацией отоларингологу.

Видео

Предлагаем к просмотру видеоролик по теме статьи.

Перекись водорода при ангине, правильное полоскание горла

Ангина – коварное заболевание, которое может развиться в любое время года. Причины, провоцирующие воспалительный процесс, зависят от различных факторов. Поэтому при возникновении тонзиллита рекомендуется сразу начинать лечение ангины перекисью водорода, не давая развиться заболеванию в более тяжелую проблему.

Ангина характеристика заболевания

При воспалительном процессе ангины, спровоцированном инфекционным заражением, на поверхности миндалин, а также на остальной части ротовой полости осуществляется усиленное размножение патогенных бактерий. К числу болезнетворных микроорганизмов, провоцирующих воспалительный процесс различных видов ангины, относятся стафилококки и стрептококки, чаще всего поражающие небные миндалины и заднюю стенку гортани.

Обычно при развитии ангины наблюдаются следующие симптомы:

  1. Болезненности на задней стенки гортани, особенно явно выражающиеся при глотании;
  2. Воспаление гланд, их припухлость и болезненность;
  3. Проявление на поверхности миндалин беловатых папул, наполненных гнойным содержанием;
  4. Увеличение в размерах лимфатических узлов, расположенных в зоне под челюстью;
  5. Фиксирование жара и повышенной температуры;
  6. Появление кашля, при котором их верхних дыхательных путей выделяется внутренняя секреция – мокрота.

Наибольшей опасностью при ангине составляет образующийся гной на поверхности гланд. Он является благоприятной средой для ускоренного развития патогенных микроорганизмов. Поэтому, чтобы не спровоцировать ухудшение болезни и прикрепление осложнений, рекомендуется при первых симптомах осуществлять полоскание горла перекисью водорода при ангине.

Эффективность полоскания раствором перекиси водорода при тонзиллите

Незначительные признаки проявляющегося заболевания рекомендуется купировать с помощью полоскания раствором перекиси водорода. Многие врачи советуют обрабатывать пораженную слизистую оболочку действенным средством, отмечая положительные результаты при использовании.перекись

Но не стоит лечить заболевание только одним препаратом. Перекись водорода не является панацеей от всех проблем, она используется только в качестве снятия признаков заболевания и должна применяться в составе комплексной терапии.

Раствор перекиси водорода при попадании в ротовую полость на поврежденные участки осуществляет такие свойства:

  1. Антисептические;
  2. Дезинфицирующие;
  3. Слабое антимикробное воздействие.

При контакте перекиси с пораженными тканями ротовой полости осуществляется окисление, благодаря чему наблюдается высвобождение большого объема активного кислорода свободного характера. Благодаря такому воздействию осуществляются следующие действия:

  1. Наблюдается механическое повреждение клеточной структуры патогенных микроорганизмов;
  2. Происходит выведение гноя из лакун в гландах;
  3. Обеззараживание углублений в миндалинах, их дезинфекция, лишающая возможности дальнейшего размножения бактерий;
  4. Снижает объем находящихся в воспаленной области токсинов, провоцирующих рост температуры и ослабленность организма;
  5. Производит очищение поверхности гланд от гнойного содержания и болезнетворного налета.

Единственным недостатком раствора перекиси водорода выступает тот момент, что средство не является стерилизующим. Жидкость осуществляет наибольший эффект только в момент прикосновения с пораженной областью, очищая поверхность от гнойного экссудата.

Назначение к применению и противопоказания

Многие пациенты интересуются можно ли полоскать горло при ангине перекисью водорода. Такую процедуру не только необходимо осуществлять для лечения, но и рекомендуется как для взрослых, так и для детей. Врачи советуют применять терапию полости рта при всех разновидностях инфекционно-воспалительных болезнях, а также при гнойных патологиях горла.

Но, не смотря на эффективность средства и отсутствие токсичности препарата, его запрещается применять бесконтрольно. В статье предоставлен перечень показаний к использованию для лечения веществом:

  1. Катаральная ангина — разновидность заболевания, выступает запущенной стадией развившейся инфекции в полости рта и на поверхности миндалин. Главным действием раствора можно считать, не только выведение остатков гноя из лакун и их дезинфекция, но и осуществление обезболивающего эффекта.
  2. Инфекции респираторного типа – вирусы, провоцирующие воспалительный процесс ангины, который необходимо лечить в первые дни протекания заболевания. Поэтом рекомендуется использовать перекись в профилактических целях в момент развития сезонных эпидемий.
  3. Фарингит – в случае, когда на слизистой поверхности рта проявляется воспаление. Такой процесс при недостаточном лечении или при отсутствии терапии провоцирует развитие серьезной патологии, в том числе распространяющейся на уши и нос. Поэтому использовать лечение перекисью водорода следует при первых начальных этапах развития проблемы.
  4. Воспалительный процесс на небных миндалинах гнойного типа – вещество, попадая на слизистую, провоцирует очистку лакун, полную одномоментную нейтрализацию патогенных микроорганизмов и устранение гнойного содержания.

Но при ангине недостаточно полоскание перекисью, следует использовать другие препараты, перечень которых можно найти на сайте в других статьях, касающихся воспалительного процесса в горле.

Главное, перед использованием рекомендуется ознакомиться с инструкцией приготовления раствора, чтобы не спровоцировать побочные явления. Поэтому перед тем как начать осуществлять процедуру полоскания стоит уточнить, есть ли у пациента противопоказания.

Выделяют следующие ситуации, при которых запрещен прием лекарства:

  1. Гиперчувствительность организма к лекарству;
  2. Плохая переносимость жидкости;
  3. Возраст ребенка, не достигающий 12 лет;
  4. Частые аллергические реакции на лекарства.

Также следует постараться не полоскать рот во время лечения ангины в момент вынашивания беременности или в период лактации. Такая процедура негативно сказывается на грудных детях или развивающемся плоде. В подобной ситуации стоит первоначально посоветоваться с наблюдающим гинекологом.

Правила разведения раствора перед полосканием

Если в горле наблюдаются ощущения першения или болезненности, свидетельствующие о первоначальных этапах формирования заболевания, стоит быстрее начинать проводить полоскание горла и ротовой полости перекисью водорода при ангине взрослым, но и детям.боль

Проведение процедуры требуется осуществлять только с соблюдением определенных правил и рекомендаций. Приготовить раствор для полоскания следует с помощью 3% вещества. Следует придерживаться определенных пропорций, указанных в рецептуре, которая отличается в зависимости от возрастной категории больного.

Для достижения эффективного итога рекомендуется придерживаться данных правил:

  1. Средство требуется готовить только перед началом полоскания, выдерживать консистенцию в течение длительного периода времени запрещено;
  2. Вещество нужно чтобы было теплым, комнатной температуры;
  3. Жидкость категорически запрещено проглатывать или пить;
  4. Перед началом мероприятия ротовую полость нужно прополоскать простой водой, затем можно применить раствор календулы или ромашки;
  5. Выпив незначительное количество вещества в течение от ½ минуты до 2-х минут следует интенсивно полоскать;
  6. После осуществления процедуры требуется развести в одном стакане по 1 ст.л. воды и соли. Последнюю можно заменить содой и прополоскать гортань и ротовую полость. Такой процесс необходим для удаления оставшейся жидкости.

Осуществлять полоскание подобным образом рекомендуется до 6-ти раз в сутки. Обязательно необходимо придерживаться правильных пропорций и лечить правильными методами. Если не выполнять поставленные условия, то лечение заболевания при первых симптомах воспалительного процесса не даст ожидаемого результата.

Необходимо развести в 100 мл кипяченой остуженной теплой воды 1 столовую ложку лекарственного средства. Также можно применить Гидроперит: 1 таблетку поместить в 0,15 л. теплой воды и полоскать каждые 3 часа. Превышать рекомендуемый минимум полоскания запрещено: быстрое устранение гноя с воспаленных миндалин приводит к иссушению слизистой гортани, что провоцирует першение и выливается в надрывный кашель.

Длительность осуществления лечения различным людям требуется проводить, контролируя собственное состояние. Если симптомы с каждым днем менее заметны, то количество полосканий можно постепенно уменьшать. Необходимо соблюдать постепенное снижение частоты применения средства, резко прекращать использование перекиси водорода в виде полоскания запрещено.

Таким образом, следует знать при ангине, как правильно полоскать горло перекисью водорода. Необходимо учитывать определенные пропорции, чтобы получить рекомендуемую концентрацию, способную быстро и эффективно устранить гнойные образования. Главное, осуществлять лечебный процесс при первых признаках воспаления и не затягивать до появления серьезных осложнений.

Полоскание горла перекисью водорода при ангине: пропорции

Ангина — одно из неприятных заболеваний, при котором облегчают состояние перекисью водорода, полоща горло. Простой, но эффективный метод уменьшает боль и уничтожает патогенную микрофлору, необходимую для размножения бактерий. Перекись водорода не является основным лекарством при недуге. Применяется как сопутствующий метод лечения. Для достижения эффекта придерживаются правил использования.

Лечение тонзиллита перекисью водорода

От боли в горле врачи советуют применять перекись. При этом заболевание может иметь любую форму. Особенность ангины в том, что болезнь является очень коварной, поскольку может глубоко проникать в мягкую ткань слизистой оболочки. От этого миндалины страдают еще больше.

Брызгать горло при ангине перекисью нужно так, чтобы жидкость попала к очагу воспаления. Струю направляют на корень языка и к миндалинам.

Рекомендовано использовать среднее количество жидкости. Необходимо, чтобы глоточная часть омылась раствором, поскольку от качества проведения процедуры зависит выздоровление.

Эффективность препарата в том, что он оказывает следующее воздействие на организм — заживляет рану, которая образовалась в результате жизнедеятельности микроорганизмов. Делается глоток, после чего голову запрокидывают назад. Человек старается производить при помощи мышц горла бурлящие звуки от 30 с. до 1 минуты. Лучше проводить процедуру после принятия пищи.

Польза перекиси водорода при ангине

Почему при лечении ангины так часто прописывают именно перекись водорода? Такое явление обусловлено высокой эффективностью средства. Благодаря дезинфицирующему действию жидкость очищает миндалины, которые покрываются гнойным содержимым.

полоскание перекисью

полоскание перекисью

Лечить горло перекисью полезно, так как вещество насыщает воспаленные ткани кислородом. В свою очередь, это ускоряет процесс заживления ран.

Благодаря правильному применению препарат оказывает на организм следующее действие:

  1. Способствует восстановлению обменных процессов.
  2. Стимулирует иммунную систему человека.
  3. Восстанавливает нормальную работу слизистой оболочки горла.
  4. За короткий промежуток времени заживляет раны в глотке.
  5. Улучшает циркуляцию крови в пораженных тканях.

Обычно специалисты назначают перекись водорода для лечения ангины. В любом случае нужна консультация с врачом, если он прописывает и другие медикаментозные средства. Человек должен знать, каким образом проходит терапия. Перекись водорода применяют для лечения взрослых и детей.

Правила приготовления раствора для полоскания

Приготовление смеси, которая рассчитана на полоскание, занимает 2-3 минуты. При этом перед процедурой человек должен иметь все необходимые компоненты.

Плюс в том, что быстрое приготовления экономит время, а это важно, если пациент чувствует боль. Результат зависит от того, насколько эффективно человек прополаскивает горло.

болезнь горла

болезнь горла

Правила проведения процедуры для лечения следующие:

  1. Концентрация средства в растворе. Для полоскания берут жидкость 3%. Препарат находится в свободной продаже и отпускается покупателю без рецепта. Стоимость невысокая, поэтому средство может позволить себя каждый человек.
  2. Приготовление и использование. 1 ч. л. перекиси развести в 200 мл теплой кипяченой воды. Тщательно перемешать и сразу же использовать по назначению. Перед каждым ополаскиванием следует делать новый раствор. Если приготовленное лекарство долго контактирует с воздухом, со временем теряет все полезные свойства и перестает действовать.
  3. Частота полосканий. Этот нюанс зависит от тяжести заболевания и самочувствия пациента. В первые дни заболевание прогрессирует, поэтому процедура повторяется 4-5 раз. Если человеку становится легче, количество полосканий уменьшают до 3 раз в день. В среднем курс лечения не превышает недели. Если состояние не улучшается или появились аллергические реакции, переходят к использованию другого препарата.

Жидкость для полоскания можно приготовить и другим способом. Для этого покупают перекись водорода в таблетках. Имеет другое название — гидроперит. Его концентрация достигает 35%. Чтобы получить привычный 3%-й раствор, который пациенты приобретают в аптеке, необходимо растворить 1 таблетку в 200 мл кипятка. После этого разводить водой до образования нужной пропорции.

ангина и нормальный зев

ангина и нормальный зев

Во время терапии ни в коем случае нельзя увеличивать концентрацию вещества.

Полезные советы

Следование простым рекомендациям улучшит процесс лечения, сделает его безболезненным и эффективным. Полоскательный сеанс всегда должен заканчиваться смыванием остатков лекарственного средства. Для этой цели подойдут отвары трав или разведенная в воде морская соль. Не рекомендуется проглатывать препарат.

Полоскать нужно ротовую полость и глотку. Такой прием снимает болезненность уже после первого сеанса, успокаивая воспаленную слизистую оболочку горла. Начинающийся тонзиллит можно вылечить за 3 дня. Для этого достаточно сразу начать полоскание при малейших признаках ангины.

Противопоказания и побочные реакции

Лечение ангины перекисью показано каждому пациенту. Единственное противопоказание к проведению процедуры — предрасположенность организма к аллергическим реакциям и индивидуальная непереносимость препарата.

перекись водорода

перекись водорода

Побочные явления возникают, если человек на момент терапии превысил концентрацию раствора. После полоскания может чувствоваться небольшое жжение, но это нормальная реакция организма. Симптом быстро проходит и не вредит человеку.

Детский организм

Многие врачи подчеркивают, что еще одним противопоказанием к лечению ангины перекисью является детский возраст. Но этим правилом можно пренебречь, если речь идет об особо опасных случаях. При этом следят за реакцией малыша на препарат. Для полоскания запрещено брать неразведенную жидкость.

При ангине у детей используют перекись водорода в виде таблеток. 1 шт. растворяют в двух стаканах теплой кипяченой воды. Такого объема будет много, тем более что каждый раз готовят новую жидкость. Достаточно взять четвертую часть таблетки и развести в стакане воды. Детский организм отличается от взрослого, поэтому не нуждается в таком количестве вещества.

свойства перекиси

свойства перекиси

При терапии сокращается не только доза гидроперита, но и число полосканий. Малыш не сможет выдержать больше 3 процедур.

Если взрослый занимается процессом после еды, то ребенок — за 20 минут до приема пищи. Процедуру проводят детям, возраст которых не меньше 6 лет.

В таком случае детям проще объяснить все тонкости полоскания и избежать проглатывания жидкости.

Полоскание горла при ангине — один из видов безопасного и безболезненного лечения. Единственный недостаток заключается в жжении, но этого нельзя избежать. Если все делать правильно, за несколько дней поверхность слизистой восстановится, и пациент почувствует себя полноценным человеком.

Полоскание горла перекисью водорода при ангине

Сегодня аптечная сеть располагает большим ассортиментом антисептических растворов, клинически испытанных и специально предназначенных для полоскания глотки при воспалении гланд.

Кроме них, предлагаются спреи, таблетки для рассасывания, жидкости для смазывания миндалин. Все эти средства безопасны, поскольку разработаны для чувствительных и нежных тканей – слизистых оболочек.

Дома некоторые люди по старинке применяют для полоскания горла перекись водорода при ангине. Выясним, какая польза этого метода.

Перекись водорода при ангине

Применение перекиси водорода в медицине

Медицинский препарат Перекись водорода – это 3%-я жидкость для наружного и местного применения. Выпускается во флаконах по 100 мл и канистрах по 20 кг.

Внимание! Согласно фармакологическому справочнику Vidal, раствор представляет собой антисептическое средство временного действия. При соприкосновении с кожей и слизистыми оболочками происходит выделение кислорода, который механически очищает поверхность от крови, гноя, и белка. При этом обеззараживающее действие на микроорганизмы кратковременно – количество бактерий лишь временно уменьшается.

Прямое назначение препарата – обработка ран, так как перекись обладает кровоостанавливающим действием. Логично возникает вопрос, можно ли полоскать горло перекисью водорода во время ангины.

Перекись водорода

В основном раствор применяется для очищения открытых повреждений кожи от прилипших бинтов и крови. Но в слабой концентрации может применяться для полоскания горла.

Внимание! Перекись водорода 3%-я относится к фармакологической группе оксидантов, то есть является окислителем. Прогрессивная медицина же использует лекарства и пищевые продукты, содержащие антиоксиданты против старости и рака.

Вот поэтому здравомыслящий человек не станет пить перекись, да ещё в не разбавленном виде, по совету несведущих в медицине «писателей» в интернете. Вдобавок, при попадании в желудок она ещё вызывает ожог его внутренних оболочек.

Эффективность использования препарата

Перекись водорода для полоскания горла при ангине применяется в такой слабой концентрации, которая не оказывает губительное воздействие на бактерии. Более сильный раствор чреват ожогом ротовой полости или возникновением аллергической реакции.

Применение перекиси водорода

Поэтому с помощью полоскания горла перекисью водорода при ангине можно лишь механически смыть с поверхности гланд накопившиеся бактерии.

Выделяющийся во время реакции кислород не обладает бактерицидным действием, но способен удалить налёт, плёнки, гнойные пробки, предупреждая разрастание очага инфекции.

В очищенных тканях восстанавливается кровоток, улучшается заживление лимфоидной ткани. Такое действие окислитель оказывает при лечении тонзиллита взрослым, надо только знать, как с пользой полоскать горло перекисью водорода при ангине.

Внимание! Жидкость предназначена лишь для смывания бактерий с поверхности гланд. Так как её антисептическое действие временное, для борьбы с воспалением наряду с полосканием этой жидкостью важно использовать антибактериальные препараты. Для лечения ангины используется Хлорофиллипт, Фарингоспрей, Хлоргексидин, Йодинол, Гексорал.

Гексорал

Противопоказания к применению

Согласно инструкции для применения по справочнику Видаля, перекись водорода противопоказана для лиц с повышенной чувствительностью к этому средству. Там же указано, что побочное действие вещества – жжение на месте обработки раневой поверхности или возникновение аллергической реакции.

Не рекомендуется применять полоскание перекисью водорода детям при ангине.

Внимание! Малыши могут проглотить окислитель, получив ожог пищевода и желудка.

Не нужно пользоваться этим способом женщинам при беременности. При попадании в желудок окисляющего средства возникают приступы тянущих болей и чувство тяжести в животе. Ожог желудка приводит к непредсказуемым последствиям.

Для смывания бактерий с миндалин можно воспользоваться безвредным содовым или солевым раствором.

Теплая вода с содой

Приготовление и использование раствора для полоскания

Внимание! Прежде чем приступить к процедуре, запомните – запрещается использовать средство в не разведённом виде.

Для полоскания горла при ангине следует приготовить жидкость в пропорции 1 ст. л. Перекиси водорода на 100 мл тёплой кипячёной воды.

Альтернативой является растворение 1 таблетки гидроперита на 200 мл. В обоих случаях растворы перемешивают ложкой для равномерного распределения окислителя.

Перекись не разбавляется минеральной водой, так как она деактивируется в щелочной среде. Для каждого полоскания готовят свежий раствор, иначе он потеряет свойство выделять кислород во время реакции.

Приготовление раствора

Как правильно полоскать горло

Для того чтобы процедура принесла пользу или хотя бы не навредила, следует узнать, как полоскать горло перекисью водорода во время ангины:

  1. Набрать в рот глоток тёплого приготовленного средства.
  2. Откинув голову назад произносить звук А-А-А на протяжении 30 секунд.
  3. Сплюнуть жидкость.
  4. Повторит процедуру, пока не кончится раствор.
  5. По окончании манипуляции промыть рот обычной водой.

После полоскания перекисью водорода вместо промывания водой полощут горло при ангине настоем шалфея, эвкалипта или ромашки. Лекарственные травы успокаивают гортань, снимают боль и воспаление в горле, нейтрализуют действие перекиси.

Как полоскать

Полоскание делают трижды в день на протяжении трёх суток. Если изменений в лучшую сторону не произошло, средство необходимо заменить.

Внимание! При возникновении аллергической реакции немедленно промойте многократно ротовую полость обычной водой. После этого примите антигистаминный препарат Тавегил или Эриус и обратитесь к ЛОР-врачу.

Что касается использования средства в детском возрасте, то лучше этот способ вообще не применять. Окислитель может попасть в глаза ребёнка и вызвать ожог.

Такой метод с большой осторожностью можно применить старшим детям, которые смогут понять, что при проглатывании перекиси водорода будет гореть желудок. Если мать всё-таки решила полоскать ребёнку горло жидкостью, то не чаще 2 раз в день.

Эриус

Перекись предназначена не для лечения ангины, а смывания с поверхности гланд налёта и бактерий. При катаральной ангине способ годится для повышения эффективности антисептических спреев и растворов. При гнойной форме тонзиллита средство может быть дополнением в комплексной терапии, в которой лечебное действие оказывают антибиотики.

Полоскание горла перекисью водорода при ангине

Полоскание горла перекисью водорода способно помочь не только на ранних этапах заболевания ангиной, но и при появлении гнойных налетов. Это средство обладает мощным антисептическим действием, в результате чего губительно влияет на патогенные микроорганизмы, способные спровоцировать развитие заболевания.

 Воздействие антисептика

Перекись водорода

Пероксид водорода характеризуется сильными окисляющими свойствами. Благодаря этому, при попадании на слизистую оболочку горла раствора активное вещество препарата вступает в реакцию, и начинает освобождаться активный кислород. Человек при этом ощущает «шипение». Перекись проникает в лакуны миндалин и выталкивает из них гной и кровь. Это приводит к тому, что воспаленная слизистая оболочка и раневые поверхности быстро и эффективно очищаются. Кроме того, горло активно увлажняется, что способствует уменьшению болевых ощущений и облегчению состояния больного. Микроорганизмы и вирусы, локализующиеся на слизистой оболочке и миндалинах, вымываются, в результате чего уменьшается их концентрация и токсическое воздействие на организм человека.

Лечение ангины перекисью водорода часто практикуют как единственный метод лечения заболевания. Особенно те люди, которые стараются избегать применения синтетических лекарственных препаратов, особенно антибиотиков. Однако достичь быстрого терапевтического эффекта этим способом можно только при возникновении первых признаков заболевания, на начальных стадиях. При возникновении осложнений в виде распространения воспалительного процесса на миндалины или появления гнойного налета полоскание перекисью водорода используется в составе комплексного лечения, то есть как вспомогательное средство.

 Как разводить препарат и полоскать горло

Перекись водорода

Поскольку перекись водорода является довольно сильнодействующим средством, лечиться им нужно очень осторожно. В первую очередь следует запомнить, что для полоскания категорически запрещено использовать неразведенное лекарство, его ни в коем случае нельзя глотать. Именно поэтому перекись не рекомендуют к применению для лечения ангины у детей. Кроме того, нельзя превышать рекомендованные дозировки и кратность применения.

Приготовить лекарство для полоскания горла можно двумя способами:

  1.  Развести 1 ст. л. 3% перекиси водорода в 100 мл теплой воды.
  2.  Растворить 1 таблетку гидроперита в 200 мл теплой воды.

Важно помнить, что полоскать горло можно только теплым раствором. Нельзя использовать слишком горячую жидкость, иначе это может привести к еще большему поражению слизистой оболочки из-за воздействия высокой температуры. А холодный раствор еще больше усугубит состояние больного.

Полоскание

Длительность проведения процедуры составляет не более 3-5 минут. Необходимо использовать весь раствор за 1 раз. Каждый раз нужно готовить свежее лекарство. С его помощью можно промыть не только слизистую оболочку горла, но и миндалины, заднюю стенку глотки, корень языка.

По окончании процедуры следует обязательно прополоскать горло теплой кипяченой водой, слабым раствором марганцовки, содой, морской водой или настоем лекарственных трав на основе ромашки, шалфея. Это необходимо для того, чтобы смыть остатки перекиси водорода и не допустить его попадания в желудок вместе с едой.

Интервал между полосканиями должен составлять не менее 3 часов.

Полоскание

Чрезмерное применение этого метода лечения может привести к ухудшению состояния здоровья больного. Поэтому нельзя делать эту процедуру чаще, чем 5 раз в день.

Если состояние пациента улучшилось, гнойные образования пропали, то лечение перекисью можно прекращать. Однако еще некоторое время следует орошать слизистую оболочку лекарственными травами.

Промывание горла перекисью водорода по Неумывакину подразумевает частое применение средства в течение дня. При этом 1 ст. л. препарата разводится в 500 мл теплой воды. В результате выходит довольно слабая концентрация, которая позволяет использовать раствор для промывания гораздо чаще, чем в обычном разведении. Это обеспечит регулярное вымывание гноя, крови и микроорганизмов из лакун. Кроме того, если присутствуют симптомы насморка, перекись водорода следует закапывать в нос — по 5 капель в каждый носовой ход.

 Показания, противопоказания и возможные побочные эффекты при использовании препарата

Лечим горло

Перекись водорода приобретает все большую популярность. Это невероятно доступный и при этом действенный метод лечения; благодаря своим выраженным антисептическим свойствам перекись быстро помогает избавиться от недуга. Кроме того, пероксид водорода успешно используют в том случае, когда возникают другие заболевания ЛОР-органов — тонзиллит, фарингит, простуда и др.

Перекись водорода практически не имеет никаких противопоказаний к применению. Исключение составляет детский возраст — из-за того, что ребенок не умеет правильно полоскать горло, поэтому лекарственное средство может попасть в желудок, а этого желательно избегать. Несмотря на то что перекись оказывает только местное воздействие, ее нужно с осторожностью использовать во время беременности и кормления грудью. При этом главное — придерживаться рекомендованных дозировок, не превышать концентрацию препарата и частоту проведения процедуры.

Полоскание горла

Только в некоторых случаях возможно возникновение реакции индивидуальной непереносимости. Из побочных эффектов чаще всего пациенты отмечают появление щипания и незначительной боли во время полоскания горла. Это обусловлено терапевтическим воздействием пероксида на воспаленную слизистую оболочку, и является вариантом нормы. При превышении концентрации перекиси водорода на языке могут воспалиться сосочки. Изредка проявляются кожные реакции — появляется сыпь и зуд. Реакции со стороны нервной системы — сонливость, быстрая утомляемость. Очень редко, но бывает тошнота, расстройство стула.

При проведении комплексной терапии ангины следует придерживаться рекомендованных интервалов между применением разных методов лечения. Минимальный промежуток между полосканием перекисью и использованием другого препарата местного воздействия составляет не менее 30 минут. В противном случае можно не получить ожидаемый положительный результат от проводимого лечения.

Эффективное лечение ангины перекисью водорода

Экология познания. Здоровье: Для борьбы с таким неприятным и весьма распространенным недугом, как ангина, существует много средств, один из них – перекись (пероксид) водорода. Это вещество может быть использовано для смазывания воспаленных миндалин и полосканий горла.

Ангина – воспалительное заболевание верхних дыхательных путей, сопровождающееся увеличением лимфоидной ткани, которая окружает вход в глотку. Там расположено несколько миндалин – при ангине они обычно покрываются налетом, а в их углублениях скапливается гной. Все это является благоприятной средой для патогенных болезнетворных микробов, которые начинают размножаться с невероятной скоростью.

Для борьбы с таким неприятным и весьма распространенным недугом, как ангина, существует много средств, один из них – перекись (пероксид) водорода. Это вещество может быть использовано для смазывания воспаленных миндалин и полосканий горла. Давно доказана эффективность перекиси водорода при лечении ангины, однако применение ее ограничено, что связано с соблюдением определенных правил.

Вещество не должно быть проглочено – это чревато осложнениями со стороны желудочно-кишечного тракта. В связи с этим пероксид ни в коем случае не применяется у детей. Перекись водорода не является основополагающим средством для терапии воспаления горла, обычно она используется в составе комплексного лечения в сочетании с другими средствами. В домашних условиях без назначения врача ее можно применять только при начальных проявлениях, дальнейшее лечение должно находиться под контролем доктора.

Действие перекиси водорода при ангине

Перекись водорода известна с древних времен и применяется в медицине, в частности, при лечении ангины, благодаря своим свойствам:

  • дезинфицирующее;
  • антисептическое;
  • антимикробное (слабое).

При ангине на миндалинах появляются беловатые налеты, а в их лакунах (углублениях) образуется и собирается гной. Под гноем и налетами активно размножаются патогенные бактерии. Слизистая оболочка миндалины при этом повреждается. При соприкосновении перекиси водорода с поврежденными тканями происходит реакция окисления и высвобождается большое количество активного свободного кислорода. В результате происходит:

  • механическое повреждение микробной клетки;
  • выталкивание гноя из углублений в миндалинах и его обезвреживание, что лишает микроорганизмы питательной среды для размножения и способствует уменьшению количества токсических веществ;
  • очищение поверхности миндалины от налета.

Перекись нельзя назвать стерилизующим раствором, она действует только в момент применения и обеспечивает одномоментное механическое удаление патологических образований. Это, помимо воздействия на сами микроорганизмы, лишает их питательной среды для размножения, тем самым облегчая симптомы болезни и способствуя скорейшему выздоровлению.

Реакция по высвобождению активного кислорода происходит только при контакте перекиси с поврежденными клетками, кровью, гноем. В этом случае на поверхности миндалин происходит обильное пенообразование. При попадании раствора на здоровую слизистую никакой реакции не произойдет.

Правила применения

При лечении ангины пероксид может применяться:

1. Для полосканий. Используется только 3% перекись водорода или гидроперит в виде таблеток. Для приготовления раствора 1 ст.л. перекиси развести в 150 мл. теплой воды или же растворить 1 таблетку гидроперита в стакане воды. Производить полоскания можно не чаще, чем раз в три часа. После каждой процедуры обязательно прополоскать горло и рот ромашкой, шалфеем или же обычной теплой водой, чтобы удалить остатки налета, гноя и самой перекиси водорода.

2. Для смазывания воспаленного горла и миндалин. Взять ватную палочку, смочить ее 3% перекисью и быстро смазать миндалины. Корень языка при этом нужно хорошо прижать шпателем или обратным концом ложки. После процедуры рот обязательно прополоскать. Метод этот неприемлем у людей с усиленным рвотным рефлексом.

Противопоказания, побочные эффекты и меры предосторожности

Пероксид водорода можно применять практически у всех, противопоказаниями могут быть только:

  • аллергические реакции;
  • непереносимость компонентов препарата;
  • детский возраст;
  • с осторожностью у беременных и кормящих женщин.

Побочные эффекты. Возможно лишь ощущение жжения в обработанных слизистых. Жжение быстро проходит, что не требует отмены лекарства, просто в следующий раз нужно будет сделать менее концентрированный раствор.

Меры предосторожности:

1. Избегать попадания в глаза. Если это случилось, нужно срочно промыть глаз большим количеством теплой воды, при сильном жжении немедленно обратиться к врачу-офтальмологу.

2. Строго соблюдать правила разведения раствора для полосканий.

3. Не использовать для полоскания или смазывания горла более 5 раз в сутки.

4. Избегать проглатывания раствора перекиси водорода, при попадании в желудок и кишечник могут возникнуть понос, рвота, тошнота, общее недомогание. Но явления эти временные, проходят очень быстро.

Таким образом, перекись водорода – действенное, проверенное временем и недорогое средство для лечения ангины. Раствор пероксида или таблетки гидроперита можно без труда найти в любой аптеке. Даже несмотря на все нюансы, при правильном и грамотном его применении скорейшее облегчение симптомов и выздоровление не заставят себя долго ждать. Но следует помнить, что самолечением заниматься все же не стоит, ведь при далеко зашедшей ангине с осложнениями применения одной лишь перекиси водорода недостаточно, так что обращение к врачу обязательно. опубликовано econet.ru 

P.S. И помните, всего лишь изменяя свое потребление – мы вместе изменяем мир! © econet

Как смешивать и применять перекись водорода в садоводстве

Хорошо, предположим, что вам нравится идея использовать перекись водорода в садоводстве, но вы просто хотите знать, как ее применять …. Хорошо, я готов объяснить!

Как обычно, есть варианты – есть несколько способов подать перекись водорода в сад.

Смешайте воду и немного перекиси водорода в ведре (или любом другом контейнере), затем полейте растения

На диаграмме показано количество воды и перекиси водорода, которое следует использовать для внесения перекиси водорода в садоводстве.Вы можете смешать перекись с целым ведром воды или просто со стаканом воды, в любом количестве.

Эту же смесь перекиси и воды можно использовать для полива комнатных растений, а также растений, которые находятся в земле. Итак, стакан воды может быть всем, что вам нужно для комнатного растения, где вам понадобится ведро, чтобы перемешать достаточно, чтобы полить дерево или
цветник. Какой бы размер емкости вы ни использовали, это достаточно просто: просто добавьте перекись, как показано на рисунке.

Убедитесь, что вы используете правильный столбец в таблице, в зависимости от того, используете ли вы 3% перекись водорода или 35% перекись водорода !!

Распыляйте перекись в саду с помощью садового опрыскивателя для внесения удобрений

Есть опрыскиватель, который можно найти в хозяйственных и садовых магазинах.Это отличный гаджет – у меня на нем написано «газонокосилка».

garden sprayer to apply hydrogen peroxide

В нем пластиковый резервуар (у меня примерно 3 стакана). Вы наполняете этот контейнер жидким удобрением (или жидкими пестицидами, я полагаю, для тех, кто использует такие ужасные вещи, но не будем туда идти)…. Затем вы прикрепляете все это к садовому шлангу … (есть разъем, который имеет резьбу как раз для подсоединения садового шланга) … Затем вы включаете шланг НА – и на выходе получается очень разбавленная комбинация того, что входит -водохранилище плюс много воды.Это приходит
выстреливает, как вода из шланга – и пользуешься
полить огород. Чтобы израсходовать 20 галлонов, нужно время.
воды, вытекающей из распылителя.

Распылитель, который у меня есть, смешивает жидкость в контейнере (примерно 3 стакана) с 20 галлонами воды. Другая модель может быть выставлена ​​на другую сумму. Во всяком случае, он откалиброван, поэтому все настроено на разбавление материала в контейнере до определенного уровня.

Поскольку мой рассчитан на 20 галлонов, мне нужно поставить
правильное количество удобрений в резервуар для обработки
20 галлонов воды .

Итак, сколько перекиси водорода следует смешать с 20 галлонами воды, чтобы кормить растения? Ответ немного варьируется в зависимости от того, какой источник вы спрашиваете. Я скажу тебе что

моя диаграмма
говорит: 3/4 стакана 35% перекиси водорода примерно на 20 галлонов воды.

(См. Таблицу для получения дополнительной информации о количестве используемой перекиси.
с различным количеством воды для использования в саду.)

Конечно, в зависимости от
другой распылитель – скажем, тот, который обрабатывает 10 галлонов воды…

Итак, поскольку резервуар моего распылителя вмещает около 3 стаканов жидкости, способ добавить ¾ стакана 35% перекиси на 20 галлонов воды с помощью этого распылителя – это разбавить перекись в жидкости.
резервуар. Налейте 3/4 стакана 35% перекиси в емкость, затем добавьте воды, чтобы заполнить ее. Эта
смесь будет смешана с 20 галлонами воды.

Кстати, это одно из приложений, где
35% перекись удобна. Проверяя график, как
много перекиси, вы увидите, что с 3% перекисью водорода вы можете использовать 10 чашек перекиси на 20 галлонов воды.Но ты
нельзя налить 10 стаканов жидкости в контейнер на 3 стакана!
Таким образом, используя 3% перекись, вам придется использовать более разбавленный раствор, который
тоже хорошо. Было бы неплохо наполнить контейнер 3 стаканами 3% перекиси – это будет несколько более разбавленным, чем необходимо, но это все равно будет работать нормально. Однако при использовании 35%
перекись водорода, вы можете лучше контролировать
концентрации, и легко использовать 3/4 стакана 35%
перекиси в распылителе – просто долейте воду до заполнения.

Используйте оставшуюся из ванны воду для подкормки растений

Если вы принимаете ванну с перекисью водорода, вы можете пропустить шланг от ванны в сад, а затем запустить сифон, чтобы перекачивать воду из ванны через шланг к растениям и почве.Вы также можете нести воду к растениям по ведру за раз.

Это просто способ повторно использовать в садоводстве ту же перекись водорода, которую вы использовали.
в ванне, чтобы впитаться, использовать ее по-другому, вместо
отправив его в канализацию.

Конечно, вы не захотите повторно использовать воду из ванны в саду, если все в воде в ванне не является биоразлагаемым и безопасным для вашего сада. Это включает: никаких коммерческих шампуней, никаких кремов для ополаскивания, никакой английской соли, никаких солевых скрабов, никаких химикатов, которые могут быть вредными для растений.

Если вы хотите повторно использовать воду из ванны в саду, вам нужно ограничиться водой, перекисью и биоразлагаемым мылом в ванне.

В таблице смешивания есть строка с количеством воды в ванне. Однако ванны различаются, поэтому ваша может вместить больше, чем 25–35 галлонов воды, которые я перечислил.

В зависимости от того, сколько перекиси водорода вы добавили в ванну, вам может потребоваться добавить дополнительную воду, чтобы еще больше разбавить перекись, перед подачей воды в сад.(См.
страницу о купании с перекисью для получения дополнительной информации!)

Опрыскивание растений перекисью водорода

Перекись водорода также может быть добавлена ​​в воду в мистере (это внекорневая подкормка, поскольку растения впитывают ее через листья). Такой же

диаграмма
также включает раствор для опрыскивания растений. (Это такое же разбавление, как и для полива растений.)

Просто используйте любое растение «господин» (устройство), которое у вас есть. Добавьте смесь воды и перекиси водорода и опрыскайте ею растения.

Итак, как лучше всего подать заявку
перекись водорода в садоводстве?

Самый простой способ начать – просто смешать перекись с
немного воды в ведре или другом контейнере и используйте его для полива
ваши растения. Тогда, если вы
хотите продолжать использовать перекись водорода в садоводстве,
вы можете попробовать все способы, которые я перечислил, чтобы увидеть, что работает
лучше для вас …. и, возможно, вы найдете еще несколько
способы применения перекиси водорода в садоводстве, которые я
не задумывался.

Возвращаемся к тому, как смешивать и применять перекись водорода в садоводстве
вернуться на главную страницу садоводства…..

Подписаться на информационный бюллетень исследователей перекиси водорода

Наша информационная рассылка будет держать вас в курсе новых добавленных страниц, а также о некоторых приключениях, которые вы можете попробовать дома:

Не беспокойтесь! Ваша электронная почта будет использоваться ТОЛЬКО для отправки вам информационных бюллетеней.

.

Что нового в Using-Hydrogen-Peroxide.com

Добро пожаловать в
Что нового страница. Вот ты
найдет сенсацию о последних
обновления на сайте.

На этой странице перечислены НОВЫЕ страницы, добавленные к сайту, и иногда я указываю страницу с серьезными изменениями. (Если я вношу небольшие изменения, их здесь нет.)

Концентрации перекиси водорода

Концентрации перекиси водорода: что означают%, сила и концентрация? Общие концентрации и для чего они используются.Преимущества и недостатки более сильных концентраций. Как развести перекись.

Читать далее «Концентрации перекиси водорода»

Цены на перекись водорода

Какая приемлемая цена на перекись? Пищевой сорт дороже? Как рассчитать сравнение цен, например 3% против 12%

Продолжить чтение «Цены на перекись водорода»

Пищевой перекись водорода и другие типы, НЕ относящиеся к пищевой

Что такое перекись водорода пищевого качества? Что это такое? Это имеет значение? Узнайте о стабилизаторах, марках, использовании пищевых продуктов и других марок HP!

Продолжить чтение «Пищевой перекись водорода и другие типы, НЕ относящиеся к пищевому качеству»

Использование перекиси в коммерческих целях

Существует множество вариантов использования перекиси водорода в коммерческих целях: отбеливание пищевых продуктов, очистка сточных вод, повышение урожайности и многое другое.

Читать далее «Коммерческое использование перекиси»

Книги по перекиси водорода

Есть тонны книг об использовании перекиси водорода. Вот некоторые из моих любимых книг о перекиси водорода.

Читать дальше «Книги о перекиси водорода»

Зубная паста слона, химический эксперимент с перекисью водорода

Зубная паста слона, химический эксперимент перекиси водорода. Видео, маршруты и множество комментариев.

Читать далее «Зубная паста слона, химический эксперимент с перекисью водорода»

Гель с перекисью водорода

Гель с перекисью водорода: когда гель лучше жидкости? Рецепт приготовления геля с перекисью водорода., а где купить крем х302.

Читать далее «Гель перекиси водорода»

Добавлен источник «чистого» перкарбоната натрия.

Меня спросили, где можно купить «чистый» перкарбонат натрия, поэтому я указываю источник для этого. Это с eBay! Я проконсультировался у одного из продавцов на eBay, и выяснилось, что продукт содержал 97% перкарбонат натрия.

Теперь я понимаю, что некоторые люди спрашивали меня о других вещах, которые я еще не добавил. Все, что я могу сказать, это то, что у меня очень длинный список дел, и впереди еще много работы.Наверное, хватит на несколько лет!

Читать далее «Источник« чистого »перкарбоната натрия».

Ванна с перекисью водорода

Как принимать ванну с перекисью водорода: сколько перекиси использовать, вопросы и ответы и предостережения.

Читать далее “Ванна с перекисью водорода”

Первые видео добавлены на сайт продолжение

CIBA VISION CLEAR CARE КОНТАКТНОЕ РЕШЕНИЕ

Я добавил 2 видео. На одном изображено пузырение перекиси водорода во время работы этого продукта.Второй показывает человека, который случайно использовал этот продукт на своих контактах, не зная, что его нужно нейтрализовать. Ей больно – видео ОБА веселое и серьезное.

Читать далее «Первые видео, добавленные на сайт, продолжение»

Первые видео, добавленные на сайт

Я добавил на сайт несколько видеороликов YouTube. Посетите эти страницы:

НОЖНАЯ ВАННА с ПЕРОКСИДОМ ВОДОРОДА

На видео показано добавление 3% перекиси водорода к стелькам обуви.

Читать дальше «Первые видеоролики добавлены на сайт»

Использование перкарбоната натрия: сухая гранулированная форма перекиси водорода

Перкарбонат натрия отлично подходит для стирки и уборки дома, прост в использовании и убивает микробы. Считайте это альтернативной формой перекиси водорода

Продолжить чтение «Использование перкарбоната натрия: сухой гранулированной формы перекиси водорода»

Перекись водорода для полоскания рта: Colgate Peroxyl

Перекись водорода для полоскания рта: вот коммерческий продукт, который рекомендует используя 1.5% перекись водорода для язв во рту, раздражений и укусов щек

Продолжить чтение «Перекись водорода для полоскания рта: Colgate Peroxyl»

Дополнительная информация о бесплатном предложении для очистителя контактных линз на основе пероксида CIBA Vision

добавьте дополнительную информацию о купоне на скидку на бесплатную бутылку CIBA Vision Clear Care – очистителя контактных линз на основе перекиси водорода.

Читать далее «Дополнительная информация о бесплатном предложении для очистителя контактных линз на основе пероксида CIBA Vision»

Перекись для парикмахерских, перекись для косметики AKA, V10, V20

Перекись для парикмахерских, также известная как перекись водорода для косметики, и V10, V20, V30 и V40

Читать далее «Перекись для парикмахерских, перекись косметической марки AKA, V10, V20»

Удалите плесень с одежды с помощью перекиси водорода

Вы можете удалить плесень с одежды с помощью перекиси водорода.Перекись убивает плесень, бактерии и вирусы, очищает пятна и плесень.

Читать далее «Удалите плесень с одежды с помощью перекиси водорода»

Ванна для ног с перекисью водорода

Идеи ванны для ног с перекисью водорода: для уничтожения стопы спортсмена и бактерий. Распылите перекись и на обувь.

Читать далее «Ванна для ног с перекисью водорода»

Использование перекиси водорода в качестве жидкости для полоскания рта

Использовать перекись водорода в качестве жидкости для полоскания рта очень просто. Полоскание горла перекисью убивает микробы.Используйте перекись в насадке Water Pik, чтобы очистить зубную щетку и многое другое ….

Читать далее «Использование перекиси водорода в качестве жидкости для полоскания рта»

Самодельный раствор для чистки ковров с использованием перекиси водорода

Как я использовал самодельный раствор для чистки ковров в арендованная машина для чистки ковров

Читать далее «Самодельный раствор для чистки ковров с использованием перекиси водорода»

Очистка пятен от ковров перекисью водорода

Использование перекиси водорода для очистки пятен от ковров – просто.

Читать далее «Очистка пятен от ковровых покрытий с помощью перекиси водорода»

Удаление плесени со стен подвала с помощью перекиси водорода

Удаление плесени со стен подвала с помощью перекиси водорода. Перекись водорода убивает плесень, бактерии и вирусы.

Читать далее «Удаление плесени на стенах подвала с помощью перекиси водорода»

Мой опыт использования перекиси водорода для лечения плесени и водорослей

Мой опыт использования перекиси водорода для лечения плесени и водорослей – избавление от черной плесени на дереве и водорослей в спортивная бутылка….

Читать далее «Мой опыт использования перекиси водорода для лечения плесени и водорослей»

.

Является ли перекись водорода подходящим индуктором апоптоза для всех типов клеток?

Перекись водорода в настоящее время является наиболее широко используемым индуктором апоптоза из-за ее широкой цитотоксической эффективности против почти всех типов клеток. Однако эквивалентная цитотоксичность достигается в широком диапазоне доз, хотя причины такой дифференциальной чувствительности не всегда ясны. В этом исследовании три вида клеток, клеточная линия 293T, первичные фибробласты и терминально дифференцированные клетки миокарда, обрабатывались широким диапазоном доз H 2 O 2 .Время до начала и окончания апоптоза измеряли цитохимически, а изменения в экспрессии каспазы-9, P53, NF-B и RIP определяли с помощью RT-PCR. Клеточная линия 293T оказалась наиболее чувствительной к H 2 O 2 , претерпев некроптоз и / или апоптоз при всех концентрациях от 0,1 до 1,6 мМ. При> 0,4 ​​мМ H 2 O 2 также вызывает некроптоз в первичных клетках. Однако при <0,4 мМ первичные клетки проявляли классические признаки апоптоза, хотя они, как правило, выживали в течение 36 часов при <0.2 мМ H 2 O 2 . Таким образом, H 2 O 2 является широко эффективным индуктором апоптоза, но диапазон доз зависит от типа клеток. Для клеточных линий требуется низкая доза, и время воздействия должно быть сокращено по сравнению с первичными клетками, чтобы избежать гибели клеток, в первую очередь, из-за некроптоза или некроза.

1. Введение.

Апоптоз клеток был впервые описан как путь гибели клеток, уникальный от некроза в 1972 году [1]. После этого было идентифицировано множество индукторов апоптоза, таких как перекись водорода (H 2 O 2 ), дитиотреитол (DTT) и окисленные ЛПНП [2–4].Среди этих агентов H 2 O 2 был наиболее широко используемым и изученным на механистическом уровне. Во многих случаях временное воздействие H 2 O 2 запускает апоптоз по митохондриальному пути, включая последовательную потерю митохондриального мембранного потенциала, высвобождение цитохрома с и активацию эффекторной каспазы-3 [5–7]. Также были идентифицированы несколько факторов, которые могут противодействовать апоптозу, индуцированному H 2 O 2 , например, фактор роста нервов (NGF) и хлорогеновая кислота [8, 9].Перекись водорода используется в качестве индуктора апоптоза для многих типов клеток, включая клеточные линии, опухолевые клетки, первичные клетки и высокодифференцированные клетки [10–15], хотя используемые дозы широко варьируются от 0,05 до 10 мМ [12–14]. , 16, 17]. Поскольку существует несколько взаимодействующих, но механически различных путей клеточной смерти, которые могут быть активированы H 2 O 2 , очень важно определить диапазоны, в которых эти пути активируются в первую очередь. Более того, такая информация может дать ценную информацию о взаимодействиях между этими путями при клеточном стрессе.Однако до сих пор нет исследования, которое систематически изучало бы различную восприимчивость к H 2 O 2 -индуцированному апоптозу среди типов клеток, что имеет решающее значение для определения, является ли H 2 O 2 подходящим индуктором апоптоза в конкретном контексте. Действительно, индуцируется ли апоптоз или некроптоз при разных дозах H 2 O 2 , часто не подтверждается [18], и апоптоз только предполагается.

Некоторые индексы могут выявить специфические аспекты процесса гибели клеток.Например, каспаза-9 может использоваться для мониторинга инициации апоптоза [19], активация NF- κ B обычно вызывается окислительным стрессом и может указывать на повреждение ДНК [20], а P53 может указывать на нарушение регуляции клетки. цикл и распространение [21]. RIP является ключевым медиатором сигнальных путей некроптоза; поэтому RIP можно использовать для отличия апоптоза от некроптоза [22].

Чтобы определить, является ли H 2 O 2 подходящим индуктором апоптоза для данного типа клеток, мы измерили цитохимические и генетические индексы апоптоза и некроптоза в диапазоне H 2 O 2 доз в трех клетках. типы, иммортализованная клеточная линия, первичные фибробласты и терминально дифференцированные кардиомиоциты.Эти клетки были выбраны из-за их отличных пролиферативных особенностей. Иммортализованная клеточная линия 293T характеризуется неограниченной пролиферацией и пассажами, в то время как фибробласты демонстрируют ограниченную пролиферацию и пассажей, а терминально дифференцированные кардиомиоциты не обнаруживают дальнейшей пролиферации. Для удобства и фибробласты, и клетки миокарда были получены из куриных эмбрионов.

2. Материалы и методы
2.1. Культура клеток

Выделение и культивирование фибробластов куриных эмбрионов и клеток миокарда выполняли методами, описанными ранее [23, 24], с некоторыми модификациями.Вкратце, яйца белого леггорна были получены от Beijing Merial Vital Laboratory Animal Technology (Пекин, Китай). На 11-й эмбриональный день (E11) эмбрионы удаляли и декапитировали в чашке Петри, наполненной средой 199 / EBSS (HyClone, Логан, Юта, США) с добавлением 3% фетальной бычьей сыворотки (FBS, Gibco, Гранд-Айленд, Нью-Йорк, США). США). Ткани желудочков и туловище куриного эмбриона выделяли для препаратов миокардиальных клеток и CEF и обрабатывали 0,05% трипсином-ЭДТА для получения клеточной суспензии, как описано [14, 25, 26] соответственно.В частности, клетки CEF и клетки миокарда, соответственно, инкубировали при 8 × 10 5 на лунку в 24-луночных планшетах в среде для выращивания (среда 199 / EBSS, содержащая 10% FBS) при 37 ° C при 5% CO. 2 атмосфера. Культуры промывали трижды через 8, 24 и 48 ч для удаления мертвых и умирающих клеток. Затем концентрацию сыворотки в среде изменяли с условий роста (10%) на условия поддержания (2%).

Клетки 293T при низком пассаже инкубировали при 1 × 10 5 клеток / лунку в 24-луночных планшетах с модифицированной Дульбекко средой Игла (DMEM) (HyClone, Логан, Юта, США), содержащей 10% FBS, при 37 ° C ниже 5% CO 2 атмосфера.После посева концентрация сыворотки снизилась от условий роста (10%) до условий поддержания (2%).

2.2. Индукция апоптоза и оценка

Каждый тип клеток был разделен на три группы: обработка H 2 O 2 , положительный контроль (обработка DTT) и отрицательный контроль. H 2 O 2 группы инкубировали в 0,1, 0,2, 0,4, 0,8 или 1,6 мМ H 2 O 2 , группы положительного контроля инкубировали в 2 мМ DTT, а группы отрицательного контроля не получали лечение.После начала воздействия каждые 0,5 ч клетки исследовали путем окрашивания AO / EB для отслеживания инициации апоптоза. Окрашивание DAPI использовали для определения времени существенного апоптоза. Затем определяли время апоптоза и выживаемость клеток с помощью окрашивания AO / EB и окрашивания DAPI. Наконец, суммарную РНК экстрагировали из клеток с помощью реагента Trizol (Invitrogen, Carlsbad, CA, USA) для оценки уровней экспрессии генов, связанных с апоптозом и некроптозом. Обратную транскрипцию проводили с использованием набора для синтеза 1-й цепи кДНК PrimeScript II (TaKaRa, Otsu, Shiga, Japan).Количественная ПЦР в реальном времени была проведена для оценки изменений уровней экспрессии каспазы-9, P53, NF- κ B и RIP с использованием праймеров и условий термоцикла, показанных в таблице 1. Средние значения групп сравнивали с помощью ANOVA с использованием программного обеспечения SPSS17.0. . Все гистограммы были созданы с помощью программного обеспечения Graphpad Prism 5.

CTCAC 1 AGTCACAGCAGCACA

5’TCTTATAGACGGCCACGGCG

5’CAAACACGGACAGGACCC


Ген Вперед Обратный Термоцикл

98/3 мин + 40 × [9/15 с; 61/40 с]
Р53 5’ACCTGCACTTACTCCCCGGT
NF-B 5’AGGACTTAAAATGGCAGGAGAG 5’GCTGTTCGTAGTGGTAAGTCTG
RIP1 5’GAACTAGGCTTCAGCAACTCCG 5 ‘GCAGCCAAAGAGGGCTTTGG
β-актина 5’GGCACCCAGCACAATGAAG 5’CCGATCCACACGGAGTACTTG

293T каспазы-9 5’TGCTGAGCAGCGAGCTGTT 5’AGCCTGCCCGCTGGAT 98 / 3 мин + 40 × [9/15 с; 61/40 с]
Р53 5’CCACCATCCACTACAACTACAT
NF-B 5’TCTCCCTGGTCACCAAGGAC 5’TCATAGAAGCCATCCCGGC
RIP1 5’CATGGAAAAGGCGTGATACAC 5 ‘ACTTCCCTCAGCTCATTGTG
β -актин 5’GGCACCCAGCACAATGAAG 5’CCGATCCACACGGAGTACTTG

3. Результаты
3.1. Время инициации апоптоза

Время инициации апоптоза при различных дозах H 2 O 2 показано на рисунке 1 для всех трех типов клеток. Время до инициации оценивали с помощью двойного окрашивания AO / EB каждые 0,5 ч под инвертированным эпифлуоресцентным микроскопом. Клетки 293T были очень чувствительны как к DTT-, так и к H 2 O 2 -индуцированному апоптозу, на что указывают более короткие задержки до инициации по сравнению с другими типами клеток.С другой стороны, время инициации апоптоза существенно не различается между клетками миокарда и фибробластами в ответ на DTT или H 2 O 2 .

3.2. Значительные различия во времени значительного апоптоза и окончания апоптоза среди типов клеток

После начала апоптоза окрашивание DAPI использовали для определения времени, в которое произошел значительный апоптоз (рис. 2). При> 0,4 ​​мМ H 2 O 2 апоптоз развивался быстро с небольшими различиями между типами клеток.Однако при ≤ 0,4 мМ время до существенного апоптоза было намного более чувствительным к дозе H 2 O 2 и типу клеток, с заметно более быстрым временем для клеток 293T, особенно при 0,4 мМ, по сравнению с фибробластами и кардиомиоцитами. Для теста на прекращение апоптоза среду (как контрольную, так и среду, содержащую H 2 O 2 ) заменяли каждые 12 часов, чтобы предотвратить снижение концентрации индуктора. Окончание апоптоза наблюдалось в течение 36 часов (рис. 3) и показало, что первичные клетки (фибробласты и кардиомиоциты) могут выжить при 0.2 мМ в течение 36 часов.


3.3. Изменения в экспрессии индикаторов апоптоза

После того, как апоптоз стал значимым, РНК каждой группы клеток была извлечена и подвергнута обратной транскрипции для анализа уровней экспрессии каспазы-9, P53, NF- κ B и RIP с помощью ПЦР в реальном времени. В клетках 293T (рис. 4) каспаза-9, P53 и NF- κ B увеличивалась при всех концентрациях H 2 O 2 . В общем, экспрессия возрастала с увеличением концентрации, но пик отличался для каспазы-9, P53 и NK- κ B (0.6 или 0,8 мМ). Тенденция к RIP была отчетливой; RIP индуцировался при всех концентрациях H 2 O 2 , в отличие от паттерна экспрессии в фибробластах (фиг.5) и кардиомиоцитах (фиг.6).



Изменения, вызванные перекисью водорода и DTT в экспрессии фибробластов генов, связанных с апоптозом и некроптозом, показаны на рисунке 5. По сравнению с клетками 293T, наблюдались различия в величине увеличения экспрессии, но общие тенденции были схожими.Заметным исключением была более высокая пороговая концентрация для активации индикатора некроптоза RIP.

Изменения в экспрессии также следовали аналогичным тенденциям в клетках миокарда (фиг. 6), хотя экспрессия NF- κ B была ниже без тенденции к зависимости от дозы. Более того, подобно фибробластам и в отличие от клеток 293T, экспрессия RIP не повышалась при самых низких концентрациях H 2 O 2 .

4. Обсуждение

Три исследованных типа клеток показали четкие различия в чувствительности к индукции апоптоза перекисью водорода и DTT.Мы предположили, что высокопролиферативные клетки будут демонстрировать самую сильную устойчивость к апоптозу, за ними следуют первичные клетки, а затем высокодифференцированные клетки. Однако оказалось, что дело обстоит с точностью до наоборот: клетки 293T демонстрируют самую быструю индукцию апоптоза в концентрациях H 2 O 2 , а также самое короткое время до существенной индукции и самое раннее завершение индукции по сравнению с фибробластами и кардиомиоциты. Более того, индукция индексов апоптоза сопровождалась усилением регуляции RIP, гена, связанного с некроптозом, при всех концентрациях H 2 O 2 .Альтернативно, терминально дифференцированные миоциты, не обладающие пролиферативной способностью, показали минимальную индукцию апоптоза при концентрациях, вызывающих существенный апоптоз / некроптоз в клетках 293T. Кроме того, внутренняя продукция АФК может отличаться от одного типа клеток к другому, и H 2 O 2 продуцируется во время нормального клеточного метаболизма, и продукция должна быть выше в быстро пролиферирующих клетках. Следовательно, используемую концентрацию H 2 O 2 следует тщательно выбирать в соответствии с клеточной моделью в исследованиях апоптоза, поскольку диапазон индукции заметно отличается для разных типов клеток.

Индекс некроптоза RIP индуцировался низкими концентрациями H 2 O 2 (0,1 и 0,2 мМ) только в клетках 293T, тогда как для индукции RIP требовалось 0,4 мМ или выше в фибробластах и ​​кардиомиоцитах. Таким образом, H 2 O 2 в концентрациях 0,2–0,4 мМ подходят для изучения «чистого» апоптоза в фибробластах и ​​кардиомиоцитах. Напротив, для изучения «чистого» апоптоза в клетках 293T могут потребоваться очень низкие дозы. Следовательно, если для определенных типов клеток использовалась неадекватная дозировка, индуцирующий апоптоз эффект H 2 O 2 не наблюдался бы, и в первую очередь следует определить подходящую дозировку для индукции апоптоза определенных типов клеток.Проведенные здесь серии измерений составляют шаблон для определения оптимального диапазона концентраций H 2 O 2 для конкретного анализа апоптоза (т.е.в отсутствии некроза или некроптоза) для данного типа клеток.

4.1. Эффективность перекиси водорода

В наших экспериментах доза перекиси водорода> 0,4 ​​мМ вызвала быструю и относительно равномерную гибель клеток, в то время как степень гибели клеток была высокочувствительной к дозе ≤ 0,4 мМ. При 0,1 и 0.2 мМ, фибробласты и кардиомиоциты выживали в течение 36 часов, в то время как наблюдалась значительная гибель клеток 293T. Клеточные линии обладают более высокой эффективностью гибели клеток, вызванной перекисью водорода. Для всех клеток время начала апоптоза зависело от дозы; индуктор с более высокой дозой имел более быструю гибель клеток. В этом эксперименте мы сначала хотели использовать проточную цитометрию для оценки, но были некоторые помехи, особенно в первичных клетках, так как отбросы могут легко окрашиваться и, таким образом, мешать оценке.Поэтому мы использовали систему флуоресцентного инверсионного микроскопа.

4.2. Факторы, контролирующие восприимчивость к перекиси водорода

Было обнаружено, что плотность клеток в 24-луночном планшете и количество поколений клеток 293T оказывают значительное влияние на время начала и окончания апоптоза. Если клеточная линия имеет высокую генерацию или плотность, она будет более чувствительна к индукции перекисью водорода. Таким образом, мы уменьшили количество трех видов клеток на лунку во время инкубации.Время начала и окончания апоптоза использовали для определения чувствительности клеток к перекиси водорода. Неожиданно было обнаружено, что клеточные линии наиболее чувствительны к перекиси водорода. Даже в более низкой дозировке перекись водорода может вызывать апоптоз клеток 293T, а апоптоз может происходить раньше и быстрее, чем другие 2 типа клеток.

4.3. Тип гибели клеток после индукции перекисью водорода

В экспериментах использовали 4 показателя для отслеживания изменений в клетках после индукции перекисью водорода.Судя по RIP, было обнаружено, что клетки 293T могут участвовать в некроптозе даже при низкой дозировке. Таким образом, если мы хотим вызвать апоптоз в клеточных линиях, мы должны сократить время действия или использовать DTT для индукции апоптоза. Что касается клеток миокарда и фибробластов, они, как правило, участвуют в некроптозе только в более высоких дозах. Из других 3 показателей можно сделать вывод, что 3 вида клеток имеют разные ответы на индукцию перекисью водорода, что показывает, что фибробласты не склонны к некроптозу после индукции от экспрессии RIP.По другим показателям фибробласты имеют более высокую экспрессию NF- κ B, что может указывать на то, что у них было больше коррозии ДНК и затруднения транскрипции. Клетки 293T имеют более высокую экспрессию P53, что указывает на нарушение клеточного цикла и пролиферации. Клетки миокарда имеют более высокую экспрессию всех показателей, что может иметь комплексный эффект.

В ходе экспериментов было обнаружено, что клетки претерпевают морфологические изменения после индукции перекисью водорода и это дозозависимо.После сравнения DTT и перекиси водорода есть много различий в 4 показателях; однако тенденция в основном сохраняется. Также было обнаружено, что перекись водорода может сильно влиять на двигательную способность клеток, но после индукции DTT в течение 6 часов импульс некоторых клеток миокарда все еще существует, и эффект апоптоза меньше, чем эффект перекиси водорода. Существующий вопрос заключается в том, обладает ли перекись водорода селективностью в различных клеточных линиях или перекись водорода имеет селективность по видам, например, в клетках крыс.

5. Заключение

Перекись водорода обладает высокой эффективностью, приводящей к гибели клеток. Перекись водорода вызывает некроптоз в клетках 293T в концентрации от 0,1 до 1,6 мМ. Клеточные линии, использованные в этом исследовании, были чувствительны к перекиси водорода. В первичных клетках концентрация> 0,4 ​​мМ также может вызывать некроптоз. Концентрация <0,4 мМ имела тенденцию к апоптозу. Первичные клетки могут выжить в перекиси водорода в течение 36 часов при концентрации ≤ 0,2 мМ. Разные клетки по-разному реагируют на индукцию перекисью водорода.Таким образом, перекись водорода квалифицируется как индуктор апоптоза в определенной дозе, соответствующей

.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *

© МУНИЦИПАЛЬНОЕ АВТОНОМНОЕ ОБЩЕОБРАЗОВАТЕЛЬНОЕ УЧРЕЖДЕНИЕ СРЕДНЯЯ ОБЩЕОБРАЗОВАТЕЛЬНАЯ ШКОЛА №3