От гайморита диоксидин: Диоксидин при гайморите и синусите: как применять, дозировка взрослому

А вы знали, что диоксидин поможет при гайморите и других лор заболеваниях

Диоксидин – серьезный препарат, к применению которого следует относиться ответственно. Если отоларинголог назначает это средство при гайморите или насморке, это свидетельствует об активном воспалении, которое требует действенного препарата.

Благодаря использованию диоксидина обеззараживаются пазухи носа и улучшается состояние организма, ведь воспаление пазух провоцирует недомогание, выделение слизи, нарушение дыхания. У человека снижается трудоспособность, развивается апатия и депрессия.

Промывание носа

Капли в нос диоксидин входят в категорию антибактериальных препаратов из группы хиноксалина. Применение этого средства требуется при болезнях, которые связаны с активностью патогенных микроорганизмов и не устраняются другими антибактериальными препаратами.

Средство назначается при выраженных воспалениях гнойного характера, которые протекают в носоглотке. Часто гайморит развивается как следствие запущенного насморка. Чтобы справиться с таким явлением, и назначают капли в нос диоксидин в ампулах.

При этом заболевании закапывания носоглотки бывает недостаточно, поэтому врачи выписывают комплексную терапию. Одной из составляющих лечения является промывание носа диоксидином при гайморите.

Диоксидин в нос при гайморите имеет довольно простой состав:

  • раствор диоксидина;
  • адреналин;
  • суспензия гидрокортизона.

Если никак не удается вылечить насморк, и он начал приобретать симптомы гайморита, закапывают диоксидин в ампулах в нос. Такое лечение можно осуществлять 5 раз в сутки. Активный компонент средства разрушает патогенные микроорганизмы и предотвращает их размножение.

Поскольку в составе присутствует гидрокортизон, диоксидин в нос взрослому при гайморите производит противоаллергическое действие. За счет адреналина сужаются сосуды носа. Благодаря использованию этого средства удается устранить воспаление и нормализовать дыхание.

Гидрокортизон

Иногда средство выписывают и детям, поскольку оно имеет несколько полезных эффектов – противовоспалительный, антибактериальный, антигистаминный, сосудосуживающий. Поэтому нет необходимости капать в носоглотку много препаратов.

Использовать данное средство допускается лишь после 12 лет. Обычно данное лекарственное вещество детям не назначают – это делают лишь при неэффективности остальных препаратов.

Способ применения

Препарат применяют лишь в том случае, если прочие антибактериальные препараты не дают результатов. Его используют при острых воспалительных процессах гнойного характера. Если возникает подозрение на гайморит, часто назначается данный лекарственный препарат.

Растворы для промывания носа при гайморите на основе средства включают воду для инъекций. Для их приготовления применяют натриевую соль и гидрокортизон. Полученным составом закапывают нос на протяжении дня. Дозировка диоксидина – несколько капель. Концентрация активного компонента составляет 0,5 %.

Суточный объем лекарственного средства делят на несколько частей. Препарат применяют от 3 до 5 раз в сутки. На продолжительность терапии влияет индивидуальная переносимость. Если болезнь приобретает запущенный характер, лечение продолжают 4-5 недель. Однако в этом случае важно следить за переносимостью средства и отсутствием побочного действия.

Промывания диоксидином и ессентуками носа от гайморита, как и другими препаратами, должно проводиться под контролем врача. Капать диоксидин в нос при беременности запрещено.

Диоксидин применяют и при гнойной ангине. При грибковом или вирусном поражении глотки использовать средство нет смысла, поскольку оно не воздействует на данные микроорганизмы. Тем более что для лечения таких патологий есть более безвредные препараты. При ангине гнойного характера диоксидин для полоскания горла применяют при неэффективности антибактериальных средств.

Для устранения этого заболевания используют ампулы, содержащие раствор 0,5 % или 1 %. Разводить диоксидин для полоскания горла нужно в кипяченой воде. Для этого подойдет и раствор натрия хлорида. Так, 1 ампулу вещества 10 мл разводят в 100 мл физиологического раствора. Полоскания делают свежим раствором 3 раза в сутки. Продолжительность терапии должен определять специалист.

Противопоказания и побочные явления

Этот препарат запрещено использовать при высокой чувствительности к активному компоненту. Противопоказанием является наличие надпочечниковой недостаточности. Запрещено применять диоксидин при беременности и лактации.

Процесс лактации

Противопоказан он и детям раннего возраста. С осторожностью подходят к применению средства при недостаточности почек. Если обойтись без него нельзя, уменьшают дозировку – решение об этом принимает исключительно специалист.

При внутреннем применении препарата иногда развиваются такие побочные эффекты:

  1. Повышение температуры.
  2. Тошнота и рвота.
  3. Аллергия.
  4. Судороги мышц.
  5. Головные боли.

При наружном использовании иногда появляется дерматит или пигментация на коже. В таких ситуациях уменьшают дозировку препарата и используют противоаллергические средства. Если это не дает результатов, лекарство отменяют. Лечение данным лекарственным веществом требует обязательного выполнения пробы на переносимость.

Если во время хранения в ампулах возникают кристаллы, их растворяют путем нагревания средства на паровой бане. Периодически емкость встряхивают, чтобы кристаллы полностью исчезли. В итоге получается абсолютно прозрачный раствор.

При использовании этого средства важно быть осторожным при вождении автомобиля и занятии опасными видами деятельности.

Диоксидин – действенное средство, которое отличается выраженными антибактериальными и противовоспалительными свойствами. Благодаря его применению удается справиться с гайморитом и другими болезнями ЛОР-органов. Главное, четко соблюдать врачебные рекомендации и дозировку.

диоксидин при гайморите — 25 рекомендаций на Babyblog.ru

Эти рекомендации основаны на многолетнем, практическом, безпункционном опыте лечения больных с воспалением придаточных пазух носа, проверенных рекомендациях научных изданий, и опыте накопленным народной медициной.

Рекомендации при гайморите, фронтите, этмоидите.

Основные задачи врача и больного в лечении заболеваний придаточных пазух носа.

1. Уменьшение воспалительного процесса в пазухах (пункты 1, 2, 3).

2. Уменьшение отека слизистой оболочки носа и пазух (пункты 1, 2, 3, 4).

3. Улучшение оттока воспалительного секрета из пазух (пункты 3, 4, 5, 6, 7, 8).

4. Уменьшение воспаления слизистой оболочки в самой полости носа (пункты 1, 2, 5, 6, 7).

5. Уменьшение активности слизистых желез в пазухах (пункт 9).

1. Применение антибиотиков.

Антибиотики применяются для уменьшения воспалительного процесса. Поскольку ослабленный заболеванием организм сам не может справиться с воспалением в этих случаях целесообразно использование антибиотиков.

Приведенный ниже список включает препараты, которые наиболее уверенно проявили себя при воспалении пазух. Выбор препарата зависит от тяжести, стадии заболевания, его цены, переносимости. Длительность приема и возрастную дозировку смотрите в инструкции. Обычно антибиотик назначается врачом при средней и тяжелой форме заболевания. Длительность применения препарата – не менее 7 дней.

Аугментин по 625 мг, 2 раза в день.

Флемоксин солютаб (грамокс, амоксил, хиконцил) по 125 -250 -500 мг, 2 -3 раза в день.

Макропен по 1 т, 3 раза в день.

Споридекс (цефалексин) по 0,25 – 0,5 г, 3 – 4 раза в день.

Цифран по 250 – 500 мг, 2 раза в день.

Ровамицин взрослым по 6 – 9 млн МЕ, 2 – 3 раза в день.

Верцеф по 250 мг, 3 раза в день.

Дурацеф по 250 – 500 мг, 1 – 2 раза в день.

Ампиокс по 0,25 – 0,5 г, 4 раза в день.

Цефазолин, цефотаксим, цефтриаксон по 0,5 – 1 г, 2 раза в день, внутримышечно.

Или другие. Дозировка зависит от возраста и тяжести заболевания.

2. Сульфаниламидные препараты.

В тяжелых случаях заболевания целесообразно применять вместе с антибиотиком и сульфаниламидные препараты. Сульфаниламиды могут применяться и самостоятельно без антибиотика при более легких вариантах заболевания или если вы не переносите антибиотики. Препарат может быть назначен врачом или применяться самостоятельно. Возрастную дозировку смотрите в инструкции.

Бисептол по 120 – 240 – 480 – 960, 2 раза в день, 7 -10 дней. Сульфадиметоксин по 1 – 2 г в 1-й приём, в следующие дни по 0,5 – 1 г, 1 раз в день, 7– 10 дней.

Этазол по 1 г, 4 – 6 раз в день, 7 – 10 дней.

3. Другие препараты.

Эти препараты применяются для устранения отдельных симптомов воспалительного процесса.

Колдакт, зестра, колди, эффект, оринол, флюколд, колдрекс, фервекс, фармацитрон и многие другие подобные (применяются по инструкции). Эти препараты уменьшают отек слизистой оболочки носа. Можно применять при резко затрудненном носовом дыхании, особенно в первые дни заболевания. Используется один препарат из списка.

Супрастин, лоратадин, димедрол, диазолин, тавегил, фенкарол.

Препараты, уменьшающие отечность слизистой оболочки, некоторые усиливают действие антибиотиков. Препараты этой группы должен назначить врач. Используется один препарат из списка, в течение 6 – 8 – 10 дней.

Бронхоклар, флюдитек, бромгексин, АЦЦ-лонг, амброксол.

Эти препараты разжижают густой гнойный секрет, способствуют более легкому его выходу из пазух. Можно применять при наличии густых, желто-зеленых выделений. Используется один препарат из списка, применять его нужно.

Циннабсин, синупрет (применять по инструкции). Это препараты с растительными компонентами, способствующие разжижению густого секрета в пазухах, уменьшению отёка и воспаления слизистой оболочки.

Гайморин. Этот гомеопатический препарат целесообразен в комплексном лечении, способствует уменьшению воспаления, отека, болевых ощущений в пазухах.

Солпадеин, цитрамон экстра, доларен, оксалгин, нимид и многие подобные. Применяются при болях, некоторые обладают общим противовоспалительным действием.

4. Самостоятельный дренаж придаточных пазух носа.

За счет разницы создаваемого вами отрицательного давления в полости носа – содержимое пазух может выйти в полость носа.

Для улучшения выхода этого содержимого и уменьшения отёка слизистой оболочки носа, предварительно используются сосудосуживающие препараты.

Закапайте в нос 2 – 3 – 4 капли или вставьте фитильки на 1-2-3-4 минуты, смоченные в сосудосуживающие капли, например в нафтизин – 0,05% – 0,1% раствор (или фармазолин, ксилометазолин, санорин, галазолин, виброцил, тизин, називин, др.). Или забрызгайте в нос аэрозоль нок-спрей. Фитилек, в данном случае – это спичка с плотно намотанной ватой. Намочите фитилек в стеклянном флаконе с нафтизином, отожмите о края флакона, чтобы раствора было немного и вставьте его в полость носа. Вставлять надо медленно, аккуратно перемещая вверх, вниз, в глубину и обратно до 5 – 8 раз, затем оставьте в полости носа на глубине половины спички, через минуту повторите массажные движения, и снова оставьте неподвижно на 1 минуту, после 3-й минуты еще раз повторите массажные движения и выньте (детям держите 1 – 2 минуты).

Через 10 – 15 минут, поочередно выдуйте каждую половину носа отдельно, затем закройте пальцами нос и пытайтесь очень сильно, как бы втягивать воздух через закрытый нос. Рот при этом должен быть тоже закрыт. Если гайморит, например, правосторонний, то голову нужно во время процедуры наклонить горизонтально к левому плечу и наоборот (еще лучше это делать лежа на боку). Для каждой стороны поочередно делается до 10 раз.

После этого целесообразно сделать промывание полости носа.

5. Промывание полости носа.

Предварительно необходимо тщательно освободить нос от содержимого по одной половинке отдельно и сразу начинать промывание. Промывание очень эффективно для освобождения носа от накопившегося отделяемого из пазух, восстановления функций слизистой оболочки.

Подберите для себя удобный вариант.

Вариант №1: вставьте наконечник спринцовки в одну половину носа на глубину примерно 1 см и направьте перпендикулярно к лицу. Голова должна быть наклонена вперед на 45 градусов. Вливайте небольшими порциями, постепенно усиливая силу струи, после 3-5 раз – очистите нос, по одной половинке и снова продолжайте промывать.

Не направляйте первые порции раствора в область переносицы – может возникнуть кратковременное жжение, из-за попадания раствора в верхние отделы носа, где расположена чувствительная, обонятельная зона.

Вариант № 2: через трубочку диаметром 5-10 мм и длиной 15-20 см втягивайте носом жидкость и сплевывайте, положение головы – как в варианте №1.

Вариант № 3: в ладонь налейте раствор и втягивайте носом, положение головы – как в варианте №1.

Растворы для промываний (выберите два из списка и чередуйте их в течение дня).

Морская соль по 1 – 1\2 ч. ложки на 1 стакан кипяченой воды.

Элекасол, сбор трав, приготовить по инструкции, развести пополам.

Ротокан, фитодент, рекутан (концетраты трав, развести 1 – 1/2 ч. ложку на 1 ст. воды).

Зеленый чай, настоять 15-20 минут.

Настой зверобоя. Настой календулы. Настой листьев черной смородины. Настой череды. Настои обычно готовят из расчета 20,0 : 200 мл (1 столовая ложка сухого измельченного растения на 1 стакан кипятка). Настаивать 15 — 30 минут.

Отвар ромашки, к отвару можно добавить 1 ст. ложку меда на 1 стакан отвара. Отвар коры дуба. Для приготовления отвара указанные лекарственные растения заливают сырой водой на 1-2 часа, а затем кипятят на медленном огне в течение 20-30 минут, постепенно помешивая. Отвары готовят в соотношении 1:10. Настои и отвары относятся к скоропортящимся лекарственным формам, поэтому желательно готовить их ежедневно. Допускается хранение их не более 2-3 суток в прохладном месте.

Фурацилин. Марганцовка (розового цвета). Декаметоксин (декасан, водный раствор). Минеральная вода (любая, без газа). Мумие 1 грамм развести на 0,5 литра кипяченой воды.

Количество раствора на одно промывание: от 100 до 250 мл. Температура раствора: 38-40 градусов. Количество промываний в день: от 2 до 4 раз. Процедуры выполняются в течение

7 – 10 – 14 дней. Выбор раствора зависит от индивидуальной переносимости, наличия в аптеке, дома. Желательно раствор морской соли чередовать в течение дня с любым перечисленным лекарством.

6. Введение лекарств в нос и пазухи.

Сразу после дренажа (или промывания), лягте на спину, запрокиньте голову назад и немного на бок, в сторону больной гайморовой пазухи. Затем в одну половину носа (с больной стороны) закапайте от 10 до 30 капель лекарства (одно из списка): фурацилин, диоксидин, микроцид, эктерицид, этоний, йодинол (для ребёнка этот препарат нужно развести в два или три раза кипячёной водой), марганцовка (розового цвета), декаметоксин (водный раствор). Это противомикробные, противовоспалительные препараты.

Через 2-3 минуты закройте пальцем противоположную от вливания половину носа и сделайте несколько сильных вдохов и выдохов половиной носа с лекарством, после этого спокойно полежите 5 минут, голову при этом выпрямите и положите на бок в больную сторону. При двухстороннем процессе – всё повторите для другой гайморовой пазухи.

Через 10 – 15 минут сделайте орошение полости носа одним из аэрозолей:

биопарокс, ингалипт, каметон, камфомен, назальный аэрозоль доктора Тайса (многокомпонентные, противовоспалительные аэрозоли), эуфорбиум композитум (комплексный, гомеопатический препарат, применяется при всех формах ринита и воспалениях придаточных пазух носа), синуфорте (очень сильный раздражитель слизистых желез, способствует более эффективному отхождению густого содержимого из пазух).

Вместо аэрозоля можно вставить в нос, на 10-20-30 минут фитильки с одним из препаратов:

пиносол (препарат из растительных компонентов, на фитильках действует эффективнее, чем в виде капель), бороментол(противовоспалительная мазь), йоддицерин (противомикробный препарат, детям нужно развести глицерином 1:2).

Выбор этих готовых, аптечных лекарств может быть обусловлен желанием или привычкой пользоваться готовыми препаратами и отсутствием свободного времени, в том случае если вы болеете, но вынуждены работать, а такие ситуации не редкие.

Если вы предпочитаете пользоваться средствами народной медицины, то можно приготовить и вставить в нос на 10-20-30 минут фитильки с такими смесями:

Смесь № 1 — по 1/2 чайной ложке хозяйственного мыла, меда и сливочного масла, смешать и растворить на водяной бане, затем еще добавить по 1/2 ч.л. сока лука, спирта и снова смешать. Эта смесь раздражает слизистые железы, что способствует лучшему выходу густого содержимого из пазух. Целесообразно применять в течение первых 3-4-5 дней лечения, при наличии густых, желто-зеленых выделений, а затем перейти на смесь №2 или №3.

Смесь № 2 — 1 ч. ложка меда + 1 ч. ложка яичного белка +1 ч. ложка сока алоэ + 1/2 ч. ложка сока лука, все смешать, хранить в холодильнике не более 4 дней.

Эту смесь можно применять самостоятельно, или после смеси №1. Перед применением подогрейте.

Смесь № 3 — смешать сок красной свеклы, сок моркови, сок лука, сок алоэ и мед в равных частях, хранить в холодильнике до 5 дней, затем приготовить снова.

Можно применять самостоятельно, или после смеси №1. Перед применением подогрейте.

Смесь № 4 — смешать по 1 ч. л. сок алоэ, коланхоэ, цикламена, лука, 1ст.л. меда и мази Вишневского. Вставлять на тампонах в нос на 20 – 30 минут, 2 раза в день. Эту смесь лучше применять при хронических гайморитах и длительностью не менее 20 дней.

А вот рецепт домашнего приготовления с аптечными компонентами (http://gaimorit.narod.ru/index.html):

1. Димексид 1 флакон.
2. Хлорофиллипт масляный раствор по 20 мл, 2 фл.
3. Пенициллин 4 флакона.
4. Алоэ.

СПОСОБ ЛЕЧЕНИЯ: cмешать четверть флакона димексида, пол флакона хлорофиллипта, один пенициллин, сок алоэ (столько же, сколько взято хлорофиллипта) в одной посуде. Получится раствор зеленого цвета. Из бинта сделать два жгута, не длинных(4-5 см) и один прямоугольник размером 5Х3. Два раза в день обмакивать жгуты в раствор, засовывать в нос, а прямоугольник из бинта тоже обмакивать и прикладывать на лоб там, где он переходит в переносицу, потом ложиться на ровное место (кровать) и лежать 15 минут. Конечно же, каждый раз необходимо делать новые жгуты и прямоугольник. раствор следует обновлять через каждые 3 – 4 дня, в связи со снижением активности пенициллина. В течение десяти дней делайте так два раза в день.

Также необходим 10-ти дневный курс антибиотиков. Антибиотики препятствуют воспалительным процессам, происходящим в носу.

Плюс к этому несколько раз в день промывайте нос раствором меда и алоэ в теплой воде. Необходимо заливать теплый раствор в одну ноздрю и пытаться вылить через другую или через горло. Через 5 дней вместе с раствором будет выходить и гной.

Моё мнение по поводу этого рецепта: он логически обоснован, однако его следует применять только детям старшего возраста и взрослым. Раствор следует обновлять через каждые 2 – 3 дня, в связи со снижением активности пенициллина и хранить в холодильнике, а перед употреблением подогревать жгутики с раствором.

7. Компрессы на придаточные пазухи носа.

(желательно применять после пункта № 6)

Компресс с соком черной редьки.

Марлю или бинт в 5-6 слоев, размером 2 на 2 см или 3 на 3 см или 4 на 4 см, (маленький размер для детей), смочите соком черной редьки и ещё слегка подогретым растительным маслом, положите это на одну, или обе гайморовые (или лобные, если имеется фронтит) пазухи. Накройте полиэтиленовой пленкой, а сверху положите мешочки с подогретой крупной солью. Детям на 30-40 минут, взрослым на 1 час, 1-2 раза в день.

Компресс с димексидом.

Применяется при болевых ощущениях в области пазух и когда на рентгенограмме придаточных пазух носа выявлена сильно утолщённая слизистая оболочка, или полипы в пазухах и носу.

5 – 6 слоев марли или бинта (размер указан выше) смочите теплым раствором димексида в разведении 1:3 или 1:4 на воде или фурацилине. Например, к 1 мл димексида добавьте 3 или 4 мл воды, разведение зависит от чувствительности кожи, возраста больного, сюда же можно добавить 0,5 мл суспензии гидрокортизона. Положите на гайморовые, или лобные пазухи, накройте полиэтиленовой пленкой, сверху тканью или ватой. Держать детям – 30 – 40 минут, взрослым — 1 час, 1-2-3 раза в день (количество зависит от переносимости компресса и наличия болевых ощущений).

Компресс с прополисом и медом.

После этого компресса лучше выходит содержимое пазух.

Разотрите или настрогайте прополис, смешайте с густым медом (по 1 ч. ложке каждого), положите в виде лепешки над гайморовой пазухой и накройте лейкопластырем. Компресс кладется перед сном на всю ночь. Утром снимите, следы от лейкопластыря удалите спиртом.

8. Прогревание придаточных пазух носа.

(можно применять после пункта № 6)

Сухое тепло можно чередовать с компрессами, или применять самостоятельно. Нельзя прогревать при сильной боли в области пазух.

Область гайморовых или лобных пазух можно прогреть сухим теплом в виде мешочков с подогретой крупной каменной или морской солью, разогретых термобигудей, сваренного куриного яйца, картофеля. Длительность прогревания — 15-20-30 минут (детям 15 минут).

В течение дня — 1-2-3 раза.

9. Уменьшение образования секрета в полости носа и пазухах.

Тысячелистник и зверобой способствуют уменьшению образования слизи в слизистых железах слизистой оболочки.

При обильных слизистых, серозных или гнойных выделениях из носа, можно принимать внутрь горячий настой тысячелистника или зверобоя, по ½ – 3/4 стакана, 2-3 раза в день, в течение 7-14 дней.

Приготовление настоя: 1 столовая ложка сухого, измельченного растения на 1 стакан крутого кипятка, настаивать 15-20 минут, профильтровать.

10. Горячие или горчичные высокие ножные ванночки. По 20 – 30 – 40 минут, 3 – 4 – 5 – 6 – 7 дней.

11. Дыхательная гимнастика для носа.

Закройте одну половину носа пальцем и сделать резкий вдох свободной половиной носа, выдохнуть воздух через рот. Повторить 8 раз, затем также 8 раз резко вдохнуть другой половиной носа, снова вернуться к противоположной половине и вдохнуть 8 раз, и так для каждой половины повторить 8 раз. В течение дня 8 раз и 8 дней подряд. Повторяйте упражнения по мере необходимости. Способствует улучшению аэрации пазух.

Общие советы по применению схемы для больного.

1. Если в течение 5-7 дней от самостоятельного лечения нет улучшения, т.е. продолжается головная боль, температура тела остаётся повышенной, дыхание носом резко затруднено и сосудосуживающие капли не помогают, плохое общее самочувствие, следует обязательно обратиться к врачу.

2. Если всего этого нет, а всё наоборот, то рекомендуемые сроки приёма лекарств – следует, всё же, выполнить, а количество процедур, указанные в пунктах 4 – 8 можно постепенно уменьшать и при действительно хорошем самочувствии и отсутствии симптомов воспаления пазух носа, описанных выше, можно совсем прекратить.

3. При покупке лекарств в аптеке всегда смотрите в инструкции, нет ли у вас противопоказаний для его приёма. Если в течение 3 – 4 дней после приёма антибиотика у Вас нет заметного улучшения его надо заменить на другой. А если Вы в период простуды уже принимали антибиотик, то посоветуйтесь с врачом о целесообразности повторного приёма, может быть он не нужен, но это зависит от тяжести заболевания.

4. Эффективность лечения будет выше, если доктор дополнительно будет промывать Вам пазухи методом «перемещения жидкости» с помощью электроотсоса.

5. Количество и набор процедур индивидуален и зависит от тяжести, длительности заболевания, свободного времени, отношения к своему заболеванию.

6. Процедуры, указанные в пунктах № 4, 5, 6, 7, 8, в течение дня могут выполняться от 2 до 4 раз, на протяжении 7-14 дней. Эти же процедуры, при хронических заболеваниях придаточных пазухах носа, могут применяться и более длительное время.

7. Дополнительное применение физиотерапевтических методов воздействия, на больные пазухи, с учётом этапности течения заболевания, также повышает эффективность лечения.

Это могут быть такие методы как: УВЧ, индуктотермия, СВЧ, микроволновая терапия, лазеротерапия, ультразвуковая терапия, магнитотерапия, биотермовибромассаж, виброакустическое воздействие аппаратом «Витафон» и др.

8. В период заболевания дополнительно принимайте витамины с микроэлементами.

9. Для профилактики (предупреждения) обострений хронического гайморита, принимайте ранней весной и осенью такие гомеопатические препараты как: циннабсин или синупрет или гайморин в течение 1 – 2 месяцев.

10. Если у вас началась простуда, обязательно в первые дни закапывайте в нос сосудосуживающие капли, для предупреждения застоя слизи в носу и пазухах. Также имеет смысл принимать препараты в состав которых входят компоненты тоже уменьшающие отёк слизистой оболочки, это такие как: колдакт, оринол, актифед, ринза, колдфлю(флюколд), фервекс, фармацитрон, колдрекс или другие подобные.

11. Занимайтесь закаливанием организма.

12. Помните: часто легче предупредить заболевание, чем потом лечить его.

Ниже приводится сокращённый вариант вышеперечисленного для распечатывания. Удобен для врача при даче рекомендаций для больного. Отмечается обведением цифры пункт, который нужен для больного в зависимости от состояния и подчёркивается лекарство или необходимая процедура, количест

как применять, эффективность и отзывы

Гайморит – это одна из разновидностей синусита. Он возникает вследствие острой респираторной инфекции, искривления носовой перегородки или наличия некоторых заболеваний. Неправильное или несвоевременное лечение этого недуга может привести к более серьезным последствиям. Очень часто доктора назначают “Диоксидин” при гайморите. Как применять, отзывы и противопоказания вы узнаете из сегодняшней статьи.

Что собой представляет данный препарат?

“Диоксидин” относится к антибиотикам, имеющим широкий спектр действия. Он эффективно борется с сальмонеллой, синегнойной палочкой, стрептококками и стафилококками. Его выпускают в виде растворов, мазей или капель. Последние изготавливаются непосредственно в аптечных пунктах. В капли, предназначенные для лечения гнойных процессов, добавляют адреналин. Он способствует сужению сосудов, вследствие чего происходит существенное уменьшение выработки слизи.

Гидрокортизон, входящий в состав данного препарата, обладает прекрасным противоаллергическим и противовоспалительным эффектом. К тому же он отлично устраняет отечность. Благодаря такому составу “Диоксидин” при гайморите (как применять этот препарат, вы узнаете далее) успешно используется в отечественной медицине.

Как действует это лекарство?

“Диоксидин” является достаточно мощным антисептиком. Он эффективно борется с болезнью, осложненной бактериальной инфекцией. При проникновении в гайморовы пазухи он убивает все имеющиеся там патогенные микроорганизмы.

Высокая эффективность данного средства обусловлена присутствием гидрокортизона. “Диоксидин” при гайморите (как применять его, вы узнаете из сегодняшней статьи) позволяет существенно сократить продолжительность лечения и не допустить развития осложнений. Действие данного лекарства направлено на полное разрушение структуры ДНК патогенных бактерий, провоцирующих возникновение воспаления в дыхательных путях.

Показания к использованию

В современной врачебной практике “Диоксидин” при гайморите (применение и отзывы можно посмотреть далее) назначают для лечения легочных воспалительных процессов, которые сопровождаются кашлем, и для борьбы с заболеваниями ЛОР-органов. Как правило, его прописывают в случае сильно затянувшегося недуга и при возникновении угрозы его перехода в хроническую форму.

Показанием к использованию “Диоксидина” может стать гнойный гайморит, синусит, ринит или фронтит. Также его выписывают при абсцессах легких, плевритах, бронхитах и пневмонии.

Противопоказания

В официальной инструкции, которая прилагается к препарату, указано, что его нельзя применять детям, не достигшим двенадцатилетнего возраста. Кроме того, “Диоксидин” нельзя использовать во время беременности. Антибактериальный препарат проникает сквозь плаценту и оказывает негативное влияние на формирование органов и систем плода. Его нежелательно применять в период грудного вскармливания, поскольку остатки препарата выделяются вместе с молоком.

Тем, кто не знает, как применять “Диоксидин” при гайморите, следует запомнить, что его нельзя использовать при эпилепсии, судорожном синдроме и индивидуальной непереносимости составляющих данного препарата.

Ингаляции с использованием “Диоксидина”

Данные процедуры обычно назначают после длительного, но малоэффективного лечения лекарственными препаратами. Они способствуют скорейшему выздоровлению пациента. Поэтому многих людей, страдающих подобными заболеваниями, интересует, как применять “Диоксидин” при гайморите.

Ингаляции желательно проводить не более двух раз в сутки. Специалисты рекомендуют делать это утром и вечером. Непосредственно перед процедурой необходимо полностью освободить носовые ходы от скопившейся там слизи. Для этого их следует промыть фурацилином. Для проведения самой ингаляции необходимо использовать не более 2,5 мл готового раствора диоксидина.

К основным преимуществам подобной процедуры можно отнести экономичный расход антибиотика, относительно невысокий риск негативного влияния препарата на почки и надпочечники. Разобравшись, как применять “Диоксидин” при гайморите для ингаляций, нужно отметить, что уже после восьми процедур врачи отмечают положительную динамику.

Как еще можно использовать “Диоксидин”?

Данный препарат можно применять не только для ингаляций. Практически в любой современной аптеке продаются различные лекарственные формы “Диоксидина”. Особенно эффективными считаются капли. Они не только помогут справиться с заболеванием, но и предотвратят повторное развитие недуга.

“Диоксидин” при гайморите (как применять его для ингаляций, можно прочесть чуть выше) в виде капель можно использовать от трех до семи дней. Продолжительность курса лечения зависит от общего состояния пациента. Также на длительность использования препарата влияет то, насколько тяжело протекает болезнь. В каждый носовой ход нужно закапывать по две капли препарата. Повторять подобную процедуру необходимо три раза в сутки.

“Диоксидин” при гайморите: как применять лекарство для лечения детей

Как уже упоминалось выше, данный препарат не рекомендуется использовать до двенадцатилетнего возраста. Кроме того, перед применением этого лекарства необходимо обязательно проконсультироваться с врачом. Это очень важно, поскольку в силу высокой токсичности “Диоксидин” может причинить вред детскому организму.

Педиатры обычно назначают его только в самых крайних случаях, когда все другие методы оказываются неэффективными. Закапывать это лекарство желательно в условиях стационара. Но при необходимости процедуру можно провести и дома. Вначале обязательно нужно очистить носовые ходы ребенка от скопившейся слизи и только после этого закапывать раствор. Делать это необходимо трижды в сутки. При проведении процедуры в домашних условиях крайне важно четко соблюдать все врачебные предписания. Средняя продолжительность лечения составляет от трех до пяти дней.

Отзывы пациентов

Следует отметить, что “Диоксидин” при гайморите (как применять его, вы узнали из сегодняшней статьи) зарекомендовал себя как надежное и очень эффективное средство. Люди, проходившие лечение данным препаратом, утверждают, что при правильном использовании он помогает даже в особо запущенных случаях.

Кроме того, пациенты отмечают, что данное средство крайне редко становится причиной аллергических реакций. Также они советуют обратить внимание на то, что в процессе хранения в ампулах могут образовываться кристаллы, для избавления от которых достаточно разогреть раствор на водяной бане.

мой метод лечения гайморита и полипов …или… как я вылечил гайморит с полипами

Многие утверждают, что гайморит и полипы вещи абсолютно не совместимые. Однако в моем случае это было не так. У меня были как полипы в носу, так и гайморит. Что я только не делал…

Для начала хочу отметить, что гайморит у меня хронический, также присутствует нафтизинозависимость. Во время своей жизни я испробовал: прогревание гайморовых пазух; прогревание луком, нагретым в масле; закапывание алоэ и каланхоэ;… Но все это не было так эффективно, как последний, выработанный метод, который использует множество компонентов. Итак, начнем.

При остром течении заболевания без антибиотиков не обойтись. При своем лечении я использовал следующие лекарства (в виде таблеток внутрь): Аугментин и Ципролет. Для разжижения отложений в гайморовых пазухах использовал Синупрет и Ринофлуимуцил. Первое это раствор, основанный на растительных компонентах, для приема внутрь. Второе- капли в нос. После того, как гной начнет движение можете использовать еще один антибиотик, но уже местного значения – капли Изофра. Параллельно с применением лекарств я позволял себе изредка прогревания гайморовых пазух.

Для освобождения от полипов применял имуно-стимулирующие средства: Вилозен, Тималин, Тимоген. Первые два представляют из себя экстракт вилочковой железы крупного рогатого скота, последний- химический аналог первых двух. Собственно про полипы в аннотации особенно ничего не сказано, но действует (по крайней мере у меня). Для борьбы с полипами в летнее время можно применить и сок чистотела.

можно также использовать (но я не испытывал на себе):

жуткий насморк
сначала Адрианол (или любые сосудосуживающие, чтоб снять отек, как врач сказала можно даже старый проверенный Галазолин или Називин) потом сложные капли:
Мезатон 1 мл / Димедрол 1 мл / Диоксидин 5 мл / Дексаметазон 1 мл / Физраствор 5 мл / все в один флакон и по 2 капли 3 раза в день(для младенцев)

как избавиться от медикаментозной зависимости:
Диоксидин 5мл, Дексаметазон 1мл, Мезатон 1мл, 5 капель аскорбиновой кислоты. Все в ампулах, 3 раза в день по две капли, 2 недели курс лечения.

промывание
эффект промывания носа при не тяжелом течении гайморита часто зависит от правильности техники проведения процедуры. Раствор для промывания должен быть приятно теплым и физиологическим (1/2 ч.л. морской соль + 1 ст. чистой кипяченой тёплой воды + 1-2 капли 5 % спиртового раствора йода или 2 таблетки годами проверенного фурациллина). Душ носу делаете так: закапываете любые сосудосуживающие капли в нос и через 10 мин. глубоко наклоняетесь над миской или ванной лицом вниз и 3-4 раза втягиваете носом заранее приготовленный раствор для промывания. При этом он выливается через рот. Затем втянуть раствор в нос и зажать нос пальцами. Не открывая нос, как бы втянуть воздух через закрытый нос (создается вакуум) и потом пытаться выдохнуть через закрытый нос (создается незначительное давление). Такое дыхания позволит вытянуть часть гноя из гайморовых полостей через соустья и частично заполнить гайморовы полости раствором для полоскания. Повторить 3 – 4 раза или до тех пор, пока не прекратится выделение жёлтого цвета слизи. Следующий этап. Встать вертикально и наклонить голову горизонтально к левому плечу и повторить вышеописанное дыхание (создаем отток из правой полости). Повторяем 3-4 раза, отдыхаем и делаем аналогично при наклоне головы вправо и затем, держа голову прямо. После процедуры в течение 1-2 часов может выливаться из носа раствор при наклонах вниз.

капли Маркова
1: сульфат цинка, стрептоцид, галазолин
2. при затяжном рините: димедрол, галазолин
3. при вирусном рините: альбуцид, галазолин, тимоген
4. о. гайморит у взр. галазолин, гентамицин, димедрол, гидрокортизон
5. хр. ринит у всех: димедрол, аминокапр. к-та, галазолин, диоксидин
6. хр. ринит у взр: аминок. к-та, димедрол, галазхолин, диоксидин, гентамицин
7. о. гайморит у детей: аминокапр. к-та, галазолин, гентамицин, гидрокортизон.

аденоиды
Лечение: мирамистин в нос 3 раза в день и внутрь сироп эреспал 3 раза в день, курс неделя; дальше – спрей назонекс 1 раз в день и внутрь лимфомиозот 3 раза в день по 10 кап. (курс месяц). Деринат можно не капать. аминокапронку не разводить (5-7сеансов). Не поможет удаляйте аденоиды.

Рекомендации при гайморите, фронтите, этмоидите, рините. Выполняется то, что для Вас отметил врач.

1. Применение антибиотиков. Для приёма во внутрь. Амоксил или грамокс, хиконцил, флемоксин, аугментин по 125 – 250 – 500 мг, 2 – 3 раза в день. Ципрофлоксацин (цифран) по 250 – 500 мг 2 раза в день. Норфлоксацин по 200 – 400 мг 2 раза в день. Офлоксацин-КМП по 1 таб., 2 раза в день. Цефалексин (споридекс) по 0,25 – 0,5 г, 3 – 4 раза в день. Верцеф по 250 мг, 3 раза в день. Доксициклин 2 сразу, затем 1 раз в день. Ампиокс по 0,25 – 0,5 г, 4 раза в день. Для инъекций. Ампиокс. Цефазолин. Цефотаксим. Цефтриаксон. По 0,5 – 1 г, 2 – 4 раза в день, в/мышечно. Один из списка или другой:

_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ Принимать в течение 6 – 7 – 8 – 9 – 10 – 11 – 12 дней.

2. Другие препараты. Бисептол по 120 – 240 – 480 – 960 (2 таб. по 480), 2 раза в день, 7 – 10 дней. Колдакт или зестра, оринол, колди, эффект по 1 капсуле, таб., 1 раз (перед сном) – 2 раза в день, 5 – 7 – 10 дней. Флюколд (колдфлю) по 1 – 1/2 т, 2 – 3 раза в день, 3 – 4 – 5 дней. Лоратадин 1 т, 1 раз в день, 7 – 8 – 10 дней. Супрастин или димедрол, диазолин, тавегил, фенкарол по 1\2 – 1 т, 2 – 3 раза в день, 4 – 6 – 8 дней. Бронхоклар или флюдитек (по инструкции). Бромгексин по 1 – 2 т, 3 – 4 раза в день, 6 – 8 – 10 дней. АЦЦ-лонг по 1 т, 1 раз в день, 6 – 8 – 10 дней. Циннабсин, синупрет (по инструкции). Гайморин по 7 гранул рассасывать первые 5 – 7 дней до 4 – 5 – 6 раз в день, а следующие дни – 2 – 3 раза в день, в течение ? – 1 – 2 – 3 месяцев, для лечения хронического гайморита гайморин принимать 6 – 9 месяцев по 7 гранул до еды ежедневно, при необходимости курс повторить после перерыва на 1-1,5 месяца. Метронидазол, метрогил (табл.), трихопол по 1 – 2 т, 3 раза в день, 6 – 8 – 10 – 12 – 14 дней. Аскорутин по 1 – 2 т, 3 раза в день, 1 – 2 – 3 недели. Цитрамон экстра, солпадеин, доларен, оксалгин по 1 т при болях. Диклофенак 1 – 2 раза в день, в\мышечно по 3 мл, при болях или 1 – 2 – 3 – 4 дня. Нимид 1 т. 2 раза в день, 5 дней.

3. Самостоятельный дренаж придаточных пазух носа после сосудосуживающих капель. Закапайте в нос 3 – 4 капли или забрызгайте по 2 – 3 дозы аэрозоля или вставьте фитильки (можно чередовать, например, 1 раз закапать, а следующий раз вставить фитильки) на 1 – 2 – 3 – 4 минуты, смоченные в сосудосуживающие капли, например в нафтизин 0,05% – 0,1% раствор или фармазолин, ксилометазолин, санорин, галазолин, нок-спрей, виброцил, тизин, називин (применять 2 – 3 – 4 раза в день, в течение 5 – 6 – 7 – 8 – 10 дней). Через 10 минут поочередно выдуйте каждую половину носа отдельно, затем закройте пальцами нос и пытайтесь очень сильно как бы втягивать воздух через закрытый нос. Рот при этом должен быть тоже закрыт. Если гайморит, например, правосторонний, то голову нужно во время процедуры наклонить горизонтально к левому плечу и наоборот (еще лучше это делать лежа на боку). Для каждой стороны поочередно делается до 10 раз. После этого целесообразно сделать промывание полости носа. После окончания указанного выше срока применения сосудосуживающих капель, дренаж можно продолжать и дальше до окончания лечения.

4. Промывание полости носа. Предварительно тщательно освободите нос от содержимого, по одной половинке отдельно и сразу начинайте промывание. Подберите для себя удобный вариант. Вариант №1: вставьте наконечник спринцовки в одну половину носа на глубину примерно 1 см и направьте перпендикулярно к лицу. Если промывается, например, правая половина, то голова должна быть наклонена вперед на 45 градусов и немного в противоположную от вливания сторону и наоборот, если промывается левая (маленьким детям можно держать голову наклонённую только вперёд). Вливайте небольшими порциями, постепенно усиливая силу струи, после 3 – 5 раз вливаний очистите нос, по одной половинке и снова продолжайте промывать. Не направляйте первые порции раствора в область переносицы – может быть кратковременное жжение из-за попадания раствора в верхние отделы носа, где расположена очень чувствительная обонятельная зона. Вариант № 2: через трубочку диаметром 5 – 10 мм и длиной 15 – 20 см втягивайте носом жидкость и сплевывайте, положение головы как в варианте №1. Вариант № 3: в ладонь налейте раствор и втягивайте носом, положение головы как в варианте №1. Растворы для промываний (выберите два из списка и чередуйте их в течение дня). Морская соль по 1 – 1\2 ч. ложке на 1 стакан кипяченой воды. Фитодент 1 – 2 ч.л. на 1 ст. воды. Отвар ромашки, на 1 стакан отвара можно добавить 1 – 1\2 ст. ложку меда и 1 ч.л. сока моркови. Отвар коры дуба. Настой зверобоя. Настой календулы. Настой листьев черной смородины. Настой череды. Фурацилин. Марганцовка (розового цвета). Элекасол, сбор трав, приготовить по инструкции, развести пополам кипячёной водой. Ротокан, рекутан (концетраты трав, развести 1 – 1/2 ч. ложку на 1 ст. воды). Зеленый чай, настоять 15 – 20 минут. Декаметоксин (водный раствор). Минеральная вода (любая, без газа). Мумие (1 грамм развести в 0,5 литра кипяченой воды). Количество раствора на одно промывание: от 100 до 250 мл. Температура раствора: 38-40 градусов. Количество промываний в день: 2 – 3 – 4 – 5 раз. Количество дней: 6 – 8 – 10 – 12 – 14 и больше.

5. Введение лекарств в нос и пазухи. Через 10 -15 минут после дренажа (или промывания) лягте на спину, запрокиньте голову назад и немного на бок, в сторону больной гайморовой пазухи. Затем в одну половину носа, с больной стороны, закапайте от 10 до 30 капель лекарства (выберите один препарат из списка): фурацилин, настой зверобоя, марганцовка (розового цвета), диоксидин, микроцид, эктерицид, этоний, декаметоксин (водный раствор). Через 2 – 3 минуты, продолжая лежать, закройте пальцем противоположную от вливания половину носа и сделайте несколько сильных вдохов и выдохов половиной носа с лекарством, после этого спокойно полежите 5 минут, голову при этом выпрямите и положите на бок в больную сторону. При двухстороннем процессе – все повторите для другой гайморовой пазухи.

6. Через 10 – 15 минут после выполнения 3 или 4 или 5 пункта сделайте следующее:

· Орошение полости носа одним из аэрозолей: биопарокс, ингалипт, каметон, камфомен, назальный аэрозоль доктора Тайса, эуфорбиум композитум, беконазе (первую неделю беконазе применять 3 раза в день, а затем ещё 2 недели, 2 раза в день, по 2 дозы в каждую половину носа, предварительно можно подсушить слизистую оболочку носа воздухом от фена, держа его на уровне подбородка, в течение 2 – 3 минут, втягивая воздух по 20 – 30 секунд с небольшими паузами, выключая в это время фен), синуфорте (по инструкции).

· Вставьте в нос на 10 – 20 – 30 минут ватные тампоны с одним из препаратов (или закапайте в каждую половину по 3 – 5 – 7 капель): пиносол, бороментол (мазь, вставлять на тампонах), протаргол, диоксидин, йоддицерин (для ребенка нужно разбавить пополам глицерином или кипячёной водой), вилозен (по 5 – 7 капель, 5 раз в день), “Краплі для носу з ментолом” (в эти капли можно добавить 1 – ? ампулу суспензии гидрокортизона и перед применением всегда взбалтывайте).

· Вставьте в нос на 5 – 10 – 20 – 30 минут тампон с одной из смесей. Смесь № 1: по 1/2 ч. ложке хозяйственного мыла, меда и сливочного масла смешайте и растворите на водяной бане, затем еще добавьте по 1/2 ч.л. сока лука, спирта и снова смешайте (для маленького ребёнка можно без спирта: в равных частях смешайте хоз. мыло, молоко, сок лука и мёд, разогрейте на водяной бане). Эту смесь можно применять первые 4 – 5 – 6 дней от начала лечения. Смесь № 2: смешайте сок кр. буряка, сок моркови, сок лука, сок алоэ и мед в равных частях. Эту смесь можно применять самостоятельно или после смеси №1 следующие дни, до окончания лечения. Смесь № 3: 1 ч. л. меда + 1 ч. ложка яичного белка + 1 ч. л. сока алоэ + 1/2 ч. л. сока лука + 1 ч.л. сока кр. буряка, все смешайте. Эту смесь можно применять самостоятельно или после смеси №1 следующие дни, до окончания лечения. Эти смеси храните в холодильнике не более 4 – 5 дней, затем приготовьте новую порцию, перед применением подогревайте.

· Отмеченные выше препараты можно чередовать между собой, применяя 1 – 2 раза каждый, в течение 6 – 7 – 8 – 9 – 10 – 12 – 14 дн.

7. Компрессы на гайморовые , лобные пазухи (желательно применять после выполнения пункта № 6). Компресс с соком черной редьки. Марлю или бинт в 5 – 6 слоёв, размером 2 на 2 см, или 3 на 3 см, или 4 на 4 см, (маленький размер для детей), смочите соком черной редьки и немного теплым растительным маслом, положите это на одну или обе гайморовы (или лобные) пазухи. Прикройте полиэтиленовой пленкой, а сверху положите мешочки с подогретой крупной солью. Детям на 20 – 30 – 40 минут, взрослым на 1 час, 1 – 2 раза вдень, в течение 4 – 5 – 6 – 7 – 8 дней.

· Компресс с димексидом. 5 – 6 слоёв марли или бинта (размер указан выше) смочите теплым р – м димексида в разведении 1 : 3 или 1 : 4 на воде или фурацилине. Например, к 1 мл димексида, добавьте 3 или 4 мл воды (разведение зависит от чувствительности кожи, возраста больного). Положите на гайморовые (и лобные) пазухи, накройте полиэтиленовой пленкой, сверху тканью или ватой. Держать детям – 30 – 40 минут, взрослым — 1 – 1,5 – 2 часа, 1 – 2 – 3 раза в день. Применять 3 – 4 – 5 – 6 – 7 – 8 дней.

· Компресс с прополисом и медом. Разотрите, настрогайте или разогрейте в микроволновке прополис и смешайте с очень густым медом (по 1 ч. ложки каждого), положите в виде лепешки на гайморовую пазуху (или обе, если воспаление с двух сторон) и накройте широким лейкопластырем или полиэтиленовой плёнкой, закрепив её лейкопластырем, можно также заложить в пустой пакетик от одноразового чая и прикрепить его лейкопластырем. Компресс кладется перед сном на всю ночь, утром снимите, следы от лейкопластыря удалите спиртом. Применять 3 – 4 – 5 – 6 – 7 – 8 дней.

8. Прогревание придаточных пазух носа (применяйте после выполнения пункта № 5). Кроме компрессов, область гайморовых или лобных пазух, можно прогреть сухим теплом, в виде мешочков с подогретой крупной каменной или морской солью, разогретых термобигудей, сваренного куриного яйца, картофеля. Длительность прогревания – 15 – 20 – 30 минут. В течение дня – 1 – 2 – 3 раза. Применять 3 – 4 – 5 – 6 – 7 – 8 дней. Можно чередовать с компрессами. Нельзя греть при болях и сильной тяжести в области пазух. В этом случае можно погреть область затылка. Начинайте прогревать со 2 – 3 – 4 дня от начала назначенного лечения.

9. Уменьшение образования секрета в полости носа и пазухах. При обильных слизистых, серозных или гнойных выделениях из носа, можно принимать внутрь горячий настой тысячелистника или зверобоя, по 3\4 – 1\2 стакана, 2 – 3 раза в день, в течение 5 – 7 – 10 – 14 дней. Приготовление настоя: 1 столовая ложка сухого, измельченного растения на 1 стакан крутого кипятка, настаивать 15 – 20 минут, профильтровать.

10. Горячие или горчичные высокие (почти до колен) ножные ванночки. По 20 – 30 – 40 минут, 3 – 4 – 5 – 6 – 7 дней.

11. Дыхательная гимнастика для носа. Нужно закрыть одну половину носа пальцем и сделать резкий вдох свободной половиной носа, выдохнуть воздух через рот. Повторить 8 раз, затем также 8 раз резко вдохнуть другой половиной носа, снова вернуться к противоположной половине и вдохнуть 8 раз, и так для каждой половины повторить 8 раз. В течение дня 8 раз и 8 дней подряд.

12. Гайморит с небольшими полипами. Если воспаление пазух сочетается с небольшими полипами в носу, то можно закапать очень теплый настой травы чистотела (1 ст. ложка на 1 стакан кипятка), капать по 3 – 5 – 7 капель, три раза с 5-минутными интервалами.

13. Физпроцедуры. УВЧ, СВЧ, индуктотермия, магнитотерапия, ультразвук, лазеротерапия,

Общие советы по применению схемы для больного.

1. Если в течение 5-7 дней от самостоятельного лечения нет улучшения, т.е. продолжается головная боль, температура тела остаётся повышенной, дыхание носом резко затруднено и сосудосуживающие капли не помогают, плохое общее самочувствие, следует обязательно обратиться к врачу.

2. Если всего этого нет, а всё наоборот, то рекомендуемые сроки приёма лекарств – следует, всё же, выполнить, а количество процедур, указанные в пунктах 4 – 8 можно постепенно уменьшать и при действительно хорошем самочувствии и отсутствии симптомов воспаления пазух носа, описанных выше, можно совсем прекратить.

3. При покупке лекарств в аптеке всегда смотрите в инструкции, нет ли у вас противопоказаний для его приёма. Если в течение 3 – 4 дней после приёма антибиотика у Вас нет заметного улучшения его надо заменить на другой. А если Вы в период простуды уже принимали антибиотик, то посоветуйтесь с врачом о целесообразности повторного приёма, может быть он не нужен, но это зависит от тяжести заболевания.

4. Эффективность лечения будет выше, если доктор дополнительно будет промывать Вам пазухи методом «перемещения жидкости» с помощью электроотсоса.

5. Количество и набор процедур индивидуален и зависит от тяжести, длительности заболевания, свободного времени, отношения к своему заболеванию.

6. Процедуры, указанные в пунктах № 4, 5, 6, 7, 8, в течение дня могут выполняться от 2 до 4 раз, на протяжении 7-14 дней. Эти же процедуры, при хронических заболеваниях придаточных пазухах носа, могут применяться и более длительное время.

7. Дополнительное применение физиотерапевтических методов воздействия, на больные пазухи, с учётом этапности течения заболевания, также повышает эффективность лечения.

Это могут быть такие методы как: УВЧ, индуктотермия, СВЧ, микроволновая терапия, лазеротерапия, ультразвуковая терапия, магнитотерапия, биотермовибромассаж, виброакустическое воздействие аппаратом «Витафон» и др.

8. В период заболевания дополнительно принимайте витамины с микроэлементами.

9. Для профилактики (предупреждения) обострений хронического гайморита, принимайте ранней весной и осенью такие гомеопатические препараты как: циннабсин или синупрет или гайморин в течение 1 – 2 месяцев.

10. Если у вас началась простуда, обязательно в первые дни закапывайте в нос сосудосуживающие капли, для предупреждения застоя слизи в носу и пазухах. Также имеет смысл принимать препараты в состав которых входят компоненты тоже уменьшающие отёк слизистой оболочки, это такие как: колдакт, оринол, актифед, ринза, колдфлю(флюколд), фервекс, фармацитрон, колдрекс или другие подобные.

11. Занимайтесь закаливанием организма.

12. Помните: часто легче предупредить заболевание, чем потом лечить его.

Внимание! У Вас нет прав для просмотра скрытого текста.

как применять (промывание носа, ингаляции и пр.) + отзывы о лечении препаратом

Диоксидин — синтетический антисептик. Используется препарат довольно широко. Основной сферой применения является наружное лечение гнойных, бактериальных инфекций. Реже антибиотик используют для внутриполостного введения и инъекций. Терапия такого заболевания, как гайморит, не предусмотрена инструкцией к препарату, но в некоторых случаях его назначают для промывания носовых пазух.

Что такое гайморит

Гайморит относится к группе широко распространённых заболеваний. Чаще всего процесс охватывает одну сторону носа, такую патологию называют односторонней. Однако бывают случаи, когда поражение коснулось двух сторон носа, что говорит о наличии двустороннего гайморита. Среди характерных признаков болезни выделяют:

  • заложенность поражённой половины носа;
  • наличие гнойных или слизистых выделений;
  • боли в носовой пазухе.

При одностороннем гайморите гной и воспаление локализируются с одной стороны, при двустроннем — с обеих

Методы диагностики и лечения болезни зависят от её вида и сопутствующих симптомов, к примеру, острая форма гайморита (возникающая на фоне ОРВИ/ОРЗ) проявляется более ярко. Человек ощущает сдавливающую боль головы, озноб, повышение температуры, дискомфорт в районе глазниц и верхней челюсти.

При хронической форме развитие болезни более медленное, а симптомы выражены слабо, что часто затрудняет диагностику.

Описание препарата Диоксидин: состав, формы выпуска, эффективность при гайморите

Медикаментозная терапия гайморита не включает в себя использование любых лекарственных форм Диоксидина в качестве основного препарата. Тем не менее, отоларингологи назначают раствор при гнойно-воспалительных процессах и для промывания носовых пазух, что продиктовано широким спектром действия антисептика, в состав которого входит:

  • активное вещество: гидроксиметилхиноксалиндиоксид (диоксидин) — 10 мг;
  • вспомогательное вещество: вода для инъекций — до 1 мл

Раствор Диоксидина используется для промывания гайморовых пазух

Руководствуясь советами специалистов, следует отметить, что использование Диоксидина оправдано лишь на тяжёлых (острых) стадиях болезни, включающих в себя:

  • затяжное, тяжёлое течение гайморита с гнойными выделениями и отсутствием реакции на антибиотик. В этом случае назначают прокол пазух (пазухи) с последующим промыванием;
  • невозможность использования другого антибиотика для промывания носовых ходов;
  • промывание пазух до и после хирургического вмешательства.

Необходимо помнить о том, что применять препарат можно только в условиях стационара. Врачи используют Диоксидин для промывания пазух во время оперативного вмешательства и крайне редко для ингаляций.

Помимо раствора, существует обладающая бактерицидными свойствами мазь Диоксидин. Использование показано лишь в случае невозможности замены другими лекарственными препаратами.

Небольшое количество мази закладывается в носовой проход с помощью ватного тампона или марлевой турунды

В редких случаях мазь применяют для закладывания в носовые проходы. Перед этим обязательно проверяют организм на отсутствие аллергических реакций. В составе мази:

  • диоксидина 5 г;
  • полиэтиленоксида 400 — 74,9 г;
  • нипагина — 0,08 г;
  • эфира пропилового параоксибензойной кислоты — 0,02 г.

Противопоказания, побочные эффекты

Диоксидин — мощный антибиотик, эффективно воздействующий даже на бактерии с невосприимчивостью к другим препаратам. Он имеет весомые противопоказания и список побочных эффектов.

К противопоказаниям относят:

  • индивидуальную непереносимость препарата в целом и каждого из компонентов в отдельности;
  • беременность, поскольку, проникая через плаценту, препарат приводит к мутациям;
  • грудное вскармливание, поскольку Диоксин проникает в молоко. Если лекарство необходимо именно в этот период, а заменить его невозможно, требуется прекратить кормление грудью;
  • возраст до 18 лет.

Помимо этого, действие препарата отрицательно сказывается на работе надпочечников и почек. Поэтому пациентам, имеющим проблемы с этими органами, лекарство также противопоказано. Одним из вариантов применения служит корректировка дозы врачом.

Препарат противопоказан в детском возрасте, при беременности и во время грудного вскармливания

Диоксидин — препарат высокотоксичной группы, что обуславливает яркую выраженность побочных эффектов при его применении, к которым относятся:

  • головная боль;
  • аллергическая реакция;
  • расстройства пищеварения;
  • озноб;
  • повышение температуры;
  • появление судорог;
  • дерматиты.

Как применять препарат

Если появятся симптомы плохой переносимости или побочные эффекты, врачи отменят препарат или скорректируют его дозировку.

Мазь

Диоксидин в форме мази используется как самостоятельно, так и в комплексе с другими необходимыми ингредиентами. При воспалении гайморовых пазух небольшое количество вещества закладывается в заранее очищенные носовые полости с помощью ватного тампона или марлевой турунды, которые потом вынимаются, осуществляется лёгкий массаж носа, чтобы равномерно распределить лекарство.

Курс терапии зависит от индивидуальных назначений и варьируется в пределах 1–3 недель.

Использовать мазь более 3 недель не рекомендуется, так как увеличивается вероятность привыкания к препарату и снижается чувствительность к его действию

Капли в нос

Раствор Диоксидина в комплексе с водой для инъекций или физраствором назначается для закапывания в нос от 3 до 5 раз в сутки в течение семи дней.

Закапывать нос нужно правильно, чтобы получить максимальный терапевтический эффект от препарата

В случае тяжёлого протекания болезни и хорошей переносимости лекарства курс может быть продлён до 30 дней. Носовые проходы предварительно очищаются.

Промывание

Перед промыванием носа Диоксидином пациенту закапывают сосудосуживающие капли или осуществляется предварительная очистка соляным раствором. Такие действия продиктованы отсутствием у препарата разжижающих слизь качеств. Приступать к процедуре можно через 10 минут после закапывания.

Наиболее простым способом считается промывка спринцовкой или шприцем без иглы, можно использовать джала-нети (специальный чайник).

Использование специальных приспособлений поможет промыть нос наиболее эффективно

Пациент наклоняется над ванной (раковиной), слегка поворачивает голову вбок и вводит раствор в ноздрю, расположенную выше. После этого голова медленно наклоняется в другую сторону, затем жидкость выливается из ноздрей.

Промывание выполняется поочерёдно, по одному разу в каждый носовой проход. Курс лечения назначается врачом индивидуально и в большинстве случаев не превышает 7 дней.

Ингаляции

Ингаляции Диоксидином назначаются редко, только в случаях если ожидаемый терапевтический эффект позволяет говорить о целесообразности их проведения. Раствор готовится в строгом соответствии врачебным назначениям.

Длительность ингаляции 2–3 минуты. Манипуляции проводят не чаще двух раз в сутки.

Продолжительность терапии устанавливается лечащим врачом в зависимости от индивидуальной переносимости препарата пациентом.

Чем заменить препарат

При выборе антибиотика для лечения гайморита следует ориентироваться на результаты мазка (взятый врачами анализ). В случае если на протяжении 48-часового периода реакция не наступила, препарат заменят. Среди вероятных причин отсутствия эффекта можно назвать сформированную устойчивость к его компонентам, а также вирусную (грибковую, аллергическую) первопричину возникновения заболевания.

Необходимо помнить, что терапевтический эффект антибиотиков наступает лишь при бактериальном поражении организма. Если первопричина заболевания аллергическая, грибковая или вирусная, средство окажется неэффективным.

Аналоги Диоксидина (антибиотики) — таблица

Отзывы

Елена Ч

http://otzovik.com/review_2491861.html

Листик

http://otzovik.com/review_916133.html

GloriaWZ

http://otzovik.com/review_4276297.html

Доктор Комаровский: что нужно знать о гайморите — видео

В целом Диоксидин показывает неплохой результат в лечении гайморита. Использовать его имеет смысл в случае отсутствия альтернативной терапии, поскольку у препарата серьёзные противопоказания и внушительный список побочных эффектов. Как и все антибиотики, Диоксидин требует осторожности применения и обязательного наблюдения врачей. Без специальных медицинских назначений использовать препарат не рекомендуется.

Здравствуйте! Меня зовут Алёна. Мне 35 лет. По образованию – медик.

Оцените статью:

Поделитесь с друзьями!

ДИОКСИДИН инструкция по применению, цена в аптеках Украины, аналоги, состав, показания | DIOXYDINUM раствор компании «Фармак»

фармакодинамика. Диоксидин — антибактериальный препарат широкого спектра действия. Эффективный при инфекциях, вызванных вульгарным протеем, синегнойной палочкой, палочкой Фридлендера, кишечной и дизентерийной палочками, сальмонеллами, стафилококками, стрептококками, патогенными анаэробами, включая возбудителей газовой гангрены. Активный относительно штаммов бактерий, резистентных к антибиотикам, сульфаниламидам, нитрофуранам и другим препаратам.

Фармакокинетика. При местном применении диоксидин частично всасывается, не оказывает местно-раздражающего действия. Не подвергается метаболизму. Не кумулируется. Выводится почками.

гнойно-воспалительные процессы различной локализации: гнойные плевриты, эмпиема плевры, абсцесс легких, перитонит, цистит, раны с глубокими полостями, абсцессы мягких тканей, флегмоны, послеоперационные раны моче- и желчевыводящих путей. Также применяется для профилактики инфекционных осложнений после катетеризации мочевого пузыря.

Диоксидин назначают только взрослым.

Перед началом курса лечения необходимо провести пробу на переносимость препарата, для чего в гнойную полость ввести 10 мл 1% р-ра. При отсутствии в течение 3–6 ч побочных явлений (головокружения, озноба, повышения температуры тела) начинают курсовое лечение. Р-р вводят в полость через дренажную трубку, катетер или шприц — обычно 10–50 мл 1% р-ра. Максимальная суточная доза составляет 70 мл 1% р-ра. Применять 1 или 2 раза в сутки (не превышая суточную дозу 70 мл 1% р-ра). Длительность лечения зависит от тяжести заболевания и переносимости препарата. Курс лечения может длиться 3 нед и более. При необходимости курс лечения повторить через 1–1,5 мес.

Применяют также местно, накладывая на поверхность раны повязки, смоченные 1% р-ром.

повышенная чувствительность к препарату, наличие в анамнезе недостаточности коры надпочечников.

аллергические реакции, включая сыпь на коже, зуд, головную боль, озноб, гиперемию кожи, диспепсию, изменения в месте применения.

диоксидин применяют только под тщательным наблюдением врача. Не допускается бесконтрольное применение Диоксидина и лекарственных форм, которые его содержат.

При появлении побочных реакций следует снизить дозу, назначить антигистаминные препараты, а при необходимости — прекратить применение Диоксидина.

Применение в период беременности и кормления грудью. Препарат противопоказан для применения в период беременности и кормления грудью.

Дети. Препарат не применяют для лечения детей.

Способность влиять на скорость реакции при управлении транспортными средствами или работе с другими механизмами. Нет данных о негативном влиянии препарата на способность управлять транспортными средствами или работать с другими механизмами.

при передозировке возможно усиление побочных эффектов. Лечение симптоматическое.

в защищенном от света месте при температуре 18–25 °C. В случае выпадения кристаллов диоксидина в ампулах в процессе хранения (при температуре <15 °С) их растворяют, нагревая ампулы на кипящей водяной бане при встряхивании до полного растворения кристаллов (прозрачный р-р). Если при охлаждении до (37±1) °С кристаллы не выпадут снова, препарат годен к использованию.

Дата добавления: 12.06.2021 г.

инструкция по применению для детей и взрослых pulmono.ru

Диоксидин – это средство с антибактериальными свойствами, которое применяют при гнойно-воспалительных процессах. Препарат включают в состав комплексного лечения при заболеваниях лор-органов. Диоксидин в нос назначают взрослым и детям при инфекции носа и придаточных пазух. Антибактериальные свойства лекарства предупреждают развитие осложнений, ускоряют процесс выздоровления.

Химический состав, фармакологическое действие препарата

Основное действующее вещество – диоксидин. Обладает бактерицидным действием, разрушает мембрану микробной клетки и вызывает её гибель.

Препарат активен относительно такой микрофлоры:

  • стафилококки;
  • стрептококки;
  • сальмонеллы;
  • шигеллы;
  • протеи;
  • эшерихии.

Применяя местно, вещество не оказывает раздражающего действия. При нанесении на раневую или воспалительную поверхность лекарство очищает её, уменьшает катаральные признаки. Возможно привыкание, поэтому при использовании важно строго соблюдать дозировку.

Диоксидин оказывает стимулирующее воздействие на восстановительные процессы эпителия, вызывает ускоренную регенерацию мягких тканей.

При нанесении на кожу и слизистые вещество всасывается в системный кровоток, беспрепятственно проникает во внутренние органы и жидкие среды. Но в мягких тканях не накапливается. Эти особенности следует учитывать при назначении препарата детям, ослабленным и пожилым пациентам, людям с хроническими внутренними болезнями.

Вещество выводится из организма почками.

Показания и лечебные свойства препарата

Диоксидин применяют в отоларингологии и педиатрии при заболеваниях носа и придаточных пазух инфекционного происхождения.

Основные показания:

  • ОРВИ, грипп, сопровождающийся интенсивным насморком;
  • острый и хронический ринит;
  • синуситы – гайморит, фронтит, этмоидит;
  • евстахиит – воспаление канала, соединяющего носоглотку и среднее ухо;
  • средний отит, который возник как осложнение на фоне респираторной инфекции.

Диоксидин от насморка назначают в случае появления гнойного экссудата. Раствор подавляет размножение инфекционных агентов и останавливает продуцирование патологической слизи. Уменьшаются симптомы ринита, восстанавливается носовое дыхание.

Препарат используют при воспалении гайморовых пазух. Его антимикробные свойства останавливают прогрессирование инфекционного процесса. Улучшение состояния наступает на вторые сутки после начала лечения. Препарат ускоряет отток мокроты из верхнечелюстных синусов, обеспечивая хорошую вентиляцию. Регулярный доступ воздуха препятствует развитию застойных процессов в пазухах, снижает риск проявления осложнений.

При закапывании капель Диоксидина в нос у пациентов проходят такие признаки:

  • зуд и раздражение слизистой;
  • чихание;
  • гиперемия и отёчность эпителия;
  • обильная гнойная или слизистая экссудация.

Препарат оказывает непрямое действие на болевые симптомы, которые возникают при заболеваниях ЛОР-органов. После нанесения раствора на воспалённую поверхность уменьшается интоксикационное воздействие патогенной флоры. В результате этого снижается интенсивность и характер болей в разных областях – лобная и височная кость, верхняя челюсть, среднее ухо. Пациент перестаёт ощущать пульсирующие, резкие или ноющие боли.

На фоне лечения гайморита Диоксидином нормализуется общее состояние больного. Улучшается качество сна, восстанавливается обоняние, появляется аппетит. Постепенно возвращается физическая активность и трудоспособность.

Назначение препарата в педиатрии

Согласно инструкции по применению, Диоксидин в нос детям не противопоказан. Местное использование менее опасно для маленького организма, сравнительно с парентеральным введением. Тем не менее раствор назначают не часто, только в случае неэффективности предшествующей терапии.

Препарат обладает средней степенью токсичности. Поэтому его чаще назначают малышам в условиях стационара. Дома капать антибиотик в нос нужно под строгим наблюдением и контролем состояния ребёнка.

Если лечение предстоит длительное, маленьким пациентам делают клинический анализ мочи для оценки функциональности мочевыделительной системы и пробу на чувствительность к антибиотику.

Диоксидин в ампулах в нос детям назначают при затяжном насморке, когда другие препараты не привели к должному результату лечения. Показаниями к использованию являются гнойные зелёные или жёлтые выделения с неприятным запахом.

По мнению авторитетного педиатра, Комаровского Е. О., раствор можно назначать не только при насморке или синусите, но и при отите, инфекции слизистой ротовой полости.

Причины, ограничивающие использование антибиотика у детей:

  • недостаточно изучены механизмы воздействия на организм ребёнка;
  • нет возможности спрогнозировать реакцию органов дыхания на воздействие препарата;
  • сохраняется риск передозировки.

Схемы применения у взрослых и детей

Диоксидин в ампулах назначают местно. Его используют для орошения, закапывания и для промывания носа.

Диоксидин Капли в нос взрослым показаны при тяжёлой форме ринита с риском осложнений. Препарат закапывают по 3-4 кап. в каждую ноздрю до 3 раз в день. Терапевтический курс, в зависимости от степени поражения эпителия, составляет от 3 до 7 дней.

Если состояние в течение 3-4 дней после начала лечения не улучшаются, присоединяют гормональные средства на основе гидрокортизона и адреналин. Такая схема предусматривает использование раствора до 5 раз в сутки. Вскрытую ампулу хранят не более 24 часов. Возможность комбинировать лекарственные средства позволяет подобрать индивидуальные схемы назначения для каждого отдельного пациента.

При лечении гайморита показаны промывания носа. С этой целью препарат разбавляют с физраствором. На 100 мл NaCl 0,9% берут одну ампулу (10 мл). Процедуру, в зависимости от интенсивности выработки гнойного экссудата проводят 1-3 раза в день.

Препарат можно использовать для ингаляционного введения с помощью специальных аппаратов. Для этого лекарство разбавляют с физраствором в соотношении 1:2.

При осложнённом течении гайморита физиотерапевтические процедуры с небольшими дозами препарата можно проводить в течение месяца.

Диоксидин при насморке детям рекомендуют назначать с 12 лет. Его не используют в чистом виде, а разбавляют с физиологическим раствором. Это связано с тем, что антибиотик способен вызвать генные мутации.

Категорически запрещено протирать эпителий ватными или марлевыми турундами, смоченными лекарством. Это может привести к химическому повреждению слизистой оболочки носовых ходов.

Детям следует развести Диоксидин для закапывания в соотношении 1:2. Вводят по 1-2 капли в каждую ноздрю 2-3 раза в день. Дозировка при гайморите может быть увеличена.

Возможные побочные явления

Лечение насморка и гайморита Диоксидином может вызывать побочные эффекты.

При попадании капель в пищеварительный тракт развиваются диспепсические расстройства:

  • изжога, тошнота, рвота;
  • дискомфорт в эпигастральной области;
  • боли в правом подреберье;
  • расстройства стула, диарея;
  • у детей – повышенное газообразование, кишечные колики;
  • лёгкая форма энтерита.

Иногда проявляются побочные действия со стороны центральной нервной системы. У пациентов возникают головные боли, головокружение, особенно при резкой смене положения тела. Наступает бессонница, расстройства качества разных фаз сна.

У детей может фиксироваться подъем температуры, и на этом фоне появляются судороги скелетных мышц, чаще верхних и нижних конечностей.

В руководстве по применению есть сведения о том, что антибактериальный препарат может вызвать негативные проявления со стороны иммунной системы в виде аллергических реакций:

  • покраснение кожи, зуд, шелушение;
  • раздражение;
  • высыпания, крапивница;
  • незначительный отёк подкожной клетчатки;
  • озноб, лихорадка.

Противопоказания к назначению

Диоксидин противопоказан при высокой чувствительности организма к химическому веществу. Его не назначают пациентам, в анамнезе которых есть аллергия к антибактериальным средствам.

Лекарство беспрепятственно проникает через гематогенный и плацентарный барьер, оказывает тератогенное воздействие на плот, создаёт риск аномального внутриутробного развития. Он также может вызвать генетические нарушения и сбои. Поэтому при беременности препарат не назначают. В случае крайней необходимости раствор могут применять во второй половине вынашивания ребёнка, при условии постоянного контроля врача и отсутствия других методов лечения.

Если в период лактации антибактериальная терапия неизбежна, то временно приостанавливают грудное вскармливание и переводят младенца на искусственное питание.

Если у пациента хроническое функциональное нарушение работы почек, то в таком случае дозировку препарата снижают. При длительном лечении периодически проводят контрольное клиническое исследование мочи.

Препарат производится в виде прозрачного раствора, без примесей, хлопьев, помутнения. Специфический запах отсутствует. Выпускается в стеклянных прозрачных ампулах объёмом 10 мл – 1%. В картонной коробке 10 шт. Также лекарство выпускается в виде мази для наружного применения в тубах по 25 и 50 мг (5%). Для внутривенного введения есть растворы в ампулах 20 мл – 0,5%.

Диоксидин при гайморите и других болезнях лор-органов показан только при отсутствии альтернативного лечения. Лекарственный раствор обладает токсичностью, поэтому его нежелательно назначать детям, пожилым, ослабленным и истощённым пациентам. При местном применении препарат менее опасен, тем не менее детям до 12 лет самостоятельно использовать его запрещено.

7 Нарушения иммунной системы | Ветераны и агент Orange: обновление 2014

Linneberg et al., 2000; Simpson et al., 2008; Хитрый, 1999). Основными формами аллергических заболеваний являются астма, аллергический ринит, атопический дерматит и желудочно-кишечные реакции. При гиперчувствительности немедленного типа реакция на некоторые аллергены, такие как пыльца и пчелиный яд, приводит к выработке антител к иммуноглобулину Е (IgE). После образования антитела IgE связываются с тучными клетками, которые представляют собой специализированные клетки, которые встречаются в тканях по всему телу, таких как дыхательные пути легких, стенка кишечника и стенки кровеносных сосудов.Когда человек снова подвергается воздействию аллергена, он связывается с антителами на тучных клетках и заставляет их выделять гистамин и лейкотриены, которые вызывают симптомы, связанные с аллергической реакцией. При реакциях гиперчувствительности замедленного типа (ГЗТ), также известных как клеточный иммунитет, другие аллергены, такие как ядовитый плющ и никель, активируют аллерген-специфические лимфоциты (Т-клетки памяти) в месте контакта (обычно на коже), который выделяют вещества, вызывающие воспаление и повреждение тканей.Некоторые аллергические реакции, например, на пищевые аллергены, могут включать комбинацию аллерген-специфического воспаления, вызванного лимфоцитами и IgE. Аллергические реакции могут проявляться в определенных тканях (например, коже, глазах, дыхательных путях и желудочно-кишечном тракте) или могут приводить к общесистемной реакции, называемой анафилаксией.

Аутоиммунные заболевания

Координационный комитет по аутоиммунным заболеваниям Национального института здравоохранения признает 80 различных аутоиммунных заболеваний и состояний, которые влияют на сердечно-сосудистую, дыхательную, нервную, эндокринную, кожную, желудочно-кишечную, печеночную и выделительную системы (Координационный комитет по аутоиммунным заболеваниям NIH, 2005).Эти заболевания поражают как мужчин, так и женщин, но большинство из них чаще поражает женщин, чем мужчин (Fairweather et al., 2008). Генетическая предрасположенность, возраст, гормональный статус и факторы окружающей среды, такие как наличие инфекционных заболеваний и стресс, как известно, влияют на риск развития аутоиммунных заболеваний, а различные аутоиммунные заболевания, как правило, возникают у одного и того же человека и группируются в семьях. Существование некоторых аутоиммунных заболеваний также является фактором риска развития других заболеваний, связанных с иммунитетом, таких как некоторые виды рака (Landgren et al., 2010).

Аутоиммунное заболевание – это пример того, что иммунная система скорее вызывает болезнь, чем предотвращает ее: иммунная система атакует собственные клетки и ткани организма, как если бы они были чужеродными. Неадекватные иммунные ответы, которые приводят к аутоиммунному заболеванию, могут быть вызваны различными компонентами иммунной системы (такими как антитела и лимфоциты) и могут быть направлены против широкого спектра тканей или органов. Например, аутоиммунная реакция при рассеянном склерозе направлена ​​против миелиновой оболочки нервной системы; при болезни Крона мишенью атаки является кишечник; при сахарном диабете 1 типа инсулинпродуцирующие клетки поджелудочной железы разрушаются иммунным ответом; а ревматоидный артрит возникает в результате иммунной атаки на суставы, хотя он также может поражать легкие, сердце и другие органы.

Антимикробная активность диоксидина и диоксидинсодержащего препарата «Нозолин-Ультра, капли назальные»

Исследование посвящено изучению антимикробной активности антиоксиданта диоксидина и комплексного диоксинсодержащего препарата Нозолин-ультра, капли назальные против планктонные и биопленочные культуры возбудителей ЛОР-инфекций, динамика формирования устойчивости микробов к диоксидину. В исследовании использованы 11 референсных штаммов и 9 клинических штаммов микроорганизмов: Streptococcus spp., Staphylococcus spp., Micrococcus luteus, Haemophilus influenzae, Acinetobacter pittii, Klebsiella pneumoniae, Moraxella catarrhalis, Pseudomonas aeruginosa. Антимикробную активность препаратов в отношении планктонных культур определяли серийным разведением в бульоне и точечным методом на твердых питательных средах, против биопленок – методом аппликатора. Динамику формирования устойчивости к диоксидину изучали путем пассирования культур в жидкой питательной среде с возрастающими концентрациями антисептика.На основании исследования было установлено, что диоксидин проявляет антимикробную активность в отношении клеток планктона всех штаммов (МБК = 0,08-5 мг / мл), за исключением S. pyogenes SN345 (МБК> 5 мг / мл), ингибирует рост образующихся биопленок. (МБК = 0,08-2,5 мг / мл) всех штаммов, кроме S. pyogenes SN345 (МБК> 5 мг / мл). Препарат «Нозолин-ультра, капли в нос» проявил высокую активность в отношении клеток планктона (МБК = 0,04-0,63 мг / мл) и биопленок (МБК = 0,02-0,31 мг / мл) грамотрицательных бактерий, за исключением A. pittii (МБК). > 2,5 мг / мл), менее активен в отношении клеток планктона (МБК = 1.25-2,5 мг / мл) и биопленки (МБК = 0,02-0,31 мг / мл) грамположительных бактерий и C. albicans. Один штамм (S. aureus) образовал вариант, устойчивый к диоксидину в концентрации 20 мг / мл, которая превышала концентрацию диоксидина в комплексном препарате; другие штаммы (P. aeruginosa, K. pneumoniae, C. albicans) таких вариантов не образуют. Полученные данные свидетельствуют о том, что препарат «Нозолин-ультра, капли в нос» может эффективно применяться против большинства возбудителей ЛОР-инфекций. Стоит отметить, что при длительном применении препарата от некоторых видов возбудителей ЛОР в дальнейшем может отмечаться небольшое снижение эффективности.

Воздействие диоксина в процессе развития и в течение всей жизни вызывает измеримые изменения в структуре и функции сердца во взрослом возрасте

  • 1.

    van der Linde, D. et al. Распространенность врожденных пороков сердца при рождении во всем мире: систематический обзор и метаанализ. J. Am. Coll. Кардиол. 58 (21), 2241–2247. https://doi.org/10.1016/j.jacc.2011.08.025 (2011).

    Артикул
    PubMed

    Google Scholar

  • 2.

    Hoffman, J. I. & Kaplan, S. Заболеваемость врожденными пороками сердца. J. Am. Coll. Кардиол. 39 (12), 1890–1900. https://doi.org/10.1016/s0735-1097(02)01886-7 (2002).

    Артикул
    PubMed

    Google Scholar

  • 3.

    Рен, К. Недоношенность, низкая масса тела при рождении и сердечно-сосудистые пороки. Педиатрия 127 (2), 385–386. https://doi.org/10.1542/peds.2010-3345 (2011).

    Артикул
    PubMed

    Google Scholar

  • 4.

    Marelli, A. et al. Оценка населения с врожденными пороками сердца в США в 2010 г .; какие числа ?. J. Am. Coll. Кардиол. 59 (13 приложение), E787. https://doi.org/10.1016/s0735-1097(12)60788-8 (2012).

    Артикул

    Google Scholar

  • 5.

    Эллиотт, Д.A. et al. Мутации гена сердечного гомеобокса NKX2-5 и врожденный порок сердца: связь с дефектом межпредсердной перегородки и синдромом гипоплазии левых отделов сердца. J. Am. Coll. Кардиол. 41 (11), 2072–2076. https://doi.org/10.1016/s0735-1097(03)00420-0 (2003).

    CAS
    Статья
    PubMed

    Google Scholar

  • 6.

    Джей, П. Ю. et al. Мутация Nkx2-5 вызывает анатомическую гипоплазию проводящей системы сердца. J. Clin. Вкладывать деньги. 113 (8), 1130–1137. https://doi.org/10.1172/jci19846 (2004).

    CAS
    Статья
    PubMed
    PubMed Central

    Google Scholar

  • 7.

    Mcelhinney, D. B., Geiger, E., Blinder, J., Benson, D. W. & Goldmuntz, E. Мутации NKX2.5 у пациентов с врожденными пороками сердца. J. Am. Coll. Кардиол. 42 (9), 1650–1655. https://doi.org/10.1016/j.jacc.2003.05.004 (2003).

    CAS
    Статья
    PubMed

    Google Scholar

  • 8.

    Pashmforoush, M. et al. Nkx2-5 путей и врожденный порок сердца; потеря спецификации клонов миоцитов желудочков приводит к прогрессирующей кардиомиопатии и полной блокаде сердца. Ячейка 117 (3), 373–386. https://doi.org/10.1016/s0092-8674(04)00405-2 (2004).

    CAS
    Статья
    PubMed

    Google Scholar

  • 9.

    Schott, J. J. et al. Врожденный порок сердца, вызванный мутациями фактора транскрипции NKX2-5. Наука 281 (5373), 108–111. https://doi.org/10.1126/science.281.5373.108 (1998).

    ADS
    CAS
    Статья
    PubMed

    Google Scholar

  • 10.

    Танака М., Чен З., Бартункова С., Ямасаки Н. и Идзумо С. Ген кардиального гомеобокса Csx / Nkx2.5 генетически расположен выше нескольких генов, необходимых для развития сердца. Разработка 126 (6), 1269–1280 (1999).

    CAS
    Статья

    Google Scholar

  • 11.

    Коуэн, Дж. Р. и Уэр, С. М. Генетика и генетическое тестирование при врожденных пороках сердца. Clin. Перинатол. 42 (2), 373–393. https://doi.org/10.1016/j.clp.2015.02.009 (2015) ( ix ).

    Артикул
    PubMed

    Google Scholar

  • 12.

    van der Bom, T. et al. Меняющаяся эпидемиология врожденных пороков сердца. Nat. Rev. Cardiol. 8 (1), 50–60. https://doi.org/10.1038/nrcardio.2010.166 (2011).

    Артикул
    PubMed

    Google Scholar

  • 13.

    Jin, S.C. et al. Вклад редких наследственных и de novo вариантов у 2871 пробанда с врожденными пороками сердца. Nat. Genet. 49 (11), 1593–1601.https://doi.org/10.1038/ng.3970 (2017).

    CAS
    Статья
    PubMed
    PubMed Central

    Google Scholar

  • 14.

    Хинтон, Р. Б. Генетические факторы и факторы окружающей среды, способствующие сердечно-сосудистым уродствам: единый подход к риску. J. Am. Сердце доц. 2 (3), e000292. https://doi.org/10.1161/jaha.113.000292 (2013).

    Артикул
    PubMed
    PubMed Central

    Google Scholar

  • 15.

    Lage, K. et al. Генетические и экологические факторы риска при врожденных пороках сердца функционально сходятся в белковых сетях, способствующих развитию сердца. Proc. Natl. Акад. Sci. СОЕДИНЕННЫЕ ШТАТЫ АМЕРИКИ. 109 (35), 14035–14040. https://doi.org/10.1073/pnas.1210730109 (2012).

    ADS
    Статья
    PubMed

    Google Scholar

  • 16.

    Веколи, С., Пулиньяни, С., Фоффа, И. и Андреасси, М. Г. Врожденные пороки сердца: перекресток генетики, эпигенетики и окружающей среды. Curr. Геном. 15 (5), 390–399. https://doi.org/10.2174/1389202

    6140716175634 (2014).

    CAS
    Статья

    Google Scholar

  • 17.

    Taegtmeyer, H., Sen, S. & Vela, D. Возвращение к программе генов плода: предполагаемая метаболическая связь с экспрессией генов в сердце. Ann. N Y Acad. Sci. 1188 , 191–198. https://doi.org/10.1111/j.1749-6632.2009.05100.x (2010).

    ADS
    CAS
    Статья
    PubMed
    PubMed Central

    Google Scholar

  • 18.

    Siedner, S. et al. Изменения в развитии сократительной способности и саркомерных белков в сердце мыши от ранней эмбриональной до взрослой стадии. J. Physiol. 548 (Pt 2), 493–505. https://doi.org/10.1113/jphysiol.2002.036509 (2003).

    CAS
    Статья
    PubMed
    PubMed Central

    Google Scholar

  • 19.

    Kruger, M., Kohl, T. & Linke, W. A. ​​Изменения в развитии пассивной жесткости и чувствительности миофиламентов Ca 2+ , вызванные переключением изоформ тайтина и тропонина-I, критически не запускаются с рождения. Am. J. Physiol. Heart Circ. Physiol. 291 (2), h596-506. https://doi.org/10.1152/ajpheart.00114.2006 (2006).

    CAS
    Статья
    PubMed

    Google Scholar

  • 20.

    Bergmann, O. et al. Доказательства обновления кардиомиоцитов у человека. Наука 324 (5923), 98–102. https://doi.org/10.1126/science.1164680 (2009).

    ADS
    CAS
    Статья
    PubMed
    PubMed Central

    Google Scholar

  • 21.

    Senyo, S.E. et al. Обновление сердца млекопитающих за счет ранее существовавших кардиомиоцитов. Природа 493 (7432), 433–436. https://doi.org/10.1038/nature11682 (2013).

    ADS
    CAS
    Статья
    PubMed

    Google Scholar

  • 22.

    Диес, Дж. Артериальная гипертензия у пациентов с сердечной недостаточностью. Сердечная недостаточность. Clin. 10 (2), 233–242. https://doi.org/10.1016/j.hfc.2013.12.004 (2014).

    Артикул
    PubMed

    Google Scholar

  • 23.

    Риттер О. и Нейзес Л. Молекулярные основы гипертрофии миокарда и сердечной недостаточности. Trends Mol. Med. 9 (7), 313–321. https://doi.org/10.1016/s1471-4914(03)00114-x (2003).

    CAS
    Статья
    PubMed

    Google Scholar

  • 24.

    Дорн, Г. У. 2-й. Нечеткая логика физиологической гипертрофии сердца. Гипертония 49 (5), 962–970. https://doi.org/10.1161/hypertensionaha.106.079426 (2007).

    CAS
    Статья
    PubMed

    Google Scholar

  • 25.

    Марон Б. Дж. И Пелличча А. Сердце тренированных спортсменов: ремоделирование сердца и риски занятий спортом, включая внезапную смерть. Тираж 114 (15), 1633–1644. https://doi.org/10.1161/circulationaha.106.613562 (2006).

    Артикул
    PubMed

    Google Scholar

  • 26.

    Вайнер, Р. Б. и Баггиш, А. Л. Острое и хроническое ремоделирование левого желудочка, вызванное физической нагрузкой. Эксперт Rev. Cardiovasc. Ther. 12 (11), 1243–1246. https://doi.org/10.1586/14779072.2014.970178 (2014).

    CAS
    Статья
    PubMed

    Google Scholar

  • 27.

    Butler, J. et al. Разработка методов лечения сердечной недостаточности с сохраненной фракцией выброса: текущее состояние и направления на будущее. JACC Сердечная недостаточность. 2 (2), 97–112. https://doi.org/10.1016/j.jchf.2013.10.006 (2014).

    Артикул
    PubMed
    PubMed Central

    Google Scholar

  • 28.

    Lam, C. S. Сердечная недостаточность с сохраненной фракцией выброса: инвазивное решение для диагностической путаницы ?. J. Am. Coll. Кардиол. 55 (16), 1711–1712. https://doi.org/10.1016/j.jacc.2009.12.034 (2010).

    Артикул
    PubMed

    Google Scholar

  • 29.

    Джонс, С. П. и Кеннеди, С. В. Культуры кардиомиоцитов куриных эмбрионов – новый подход к изучению воздействия галогенированных ароматических углеводородов на сердце птиц. Toxicol. Sci. 109 (1), 66–74. https://doi.org/10.1093/toxsci/kfp039 (2009 г.).

    CAS
    Статья
    PubMed

    Google Scholar

  • 30.

    Wang, Q. et al. Нарушение гомеостатических уровней арилуглеводородных рецепторов во время дифференцировки эмбриональных стволовых клеток изменяет экспрессию факторов транскрипции гомеобокса, которые контролируют кардиомиогенез. Environ. Перспектива здоровья. 121 (11–12), 1334–1343. https://doi.org/10.1289/ehp.1307297 (2013).

    Артикул
    PubMed
    PubMed Central

    Google Scholar

  • 31.

    Abbott, B.D. et al. Неблагоприятные репродуктивные результаты у трансгенных мышей с дефицитом рецептора Ah. Toxicol. Прил. Pharmacol. 155 (1), 62–70. https://doi.org/10.1006/taap.1998.8601 (1999).

    CAS
    Статья
    PubMed

    Google Scholar

  • 32.

    Aragon, AC, Kopf, PG, Campen, MJ, Huwe, JK & Walker, MK Внутриутробное и лактационное воздействие 2,3,7,8-тетрахлордибензо-p-диоксина: влияние на экспрессию сердечных генов у плода и взрослого человека и сердечную деятельность взрослых и морфология почек. Toxicol. Sci. 101 (2), 321–330. https://doi.org/10.1093/toxsci/kfm272 (2008).

    CAS
    Статья
    PubMed

    Google Scholar

  • 33.

    Карро, Т., Дин, К. и Оттингер, М.A. Влияние экологически значимой смеси полихлорированных бифенилов (ПХБ) на выживаемость эмбрионов и развитие сердца домашних цыплят. Environ. Toxicol. Chem. 32 (6), 1325–1331. https://doi.org/10.1002/etc.2178 (2013).

    CAS
    Статья
    PubMed

    Google Scholar

  • 34.

    Dalton, T. P. et al. Воздействие диоксина является экологическим фактором риска ишемической болезни сердца. Cardiovasc. Toxicol. 1 (4), 285–298. https://doi.org/10.1385/ct:1:4:285 (2001).

    CAS
    Статья
    PubMed

    Google Scholar

  • 35.

    Hofsteen, P., Mehta, V., Kim, M. S., Peterson, R. E. и Heideman, W. TCDD подавляет регенерацию сердца у взрослых рыбок данио. Toxicol. Sci. 132 (1), 211–221. https://doi.org/10.1093/toxsci/kfs329 (2013).

    CAS
    Статья
    PubMed

    Google Scholar

  • 36.

    Пуга, А. Перспективы потенциального участия оси рецептор-диоксин АГ в сердечно-сосудистых заболеваниях. Toxicol. Sci. 120 (2), 256–261. https://doi.org/10.1093/toxsci/kfq393 (2011 г.).

    CAS
    Статья
    PubMed

    Google Scholar

  • 37.

    Йошиока, В., Петерсон, Р. Э. и Тохьяма, К. Молекулярные мишени, которые связывают воздействие диоксина с фенотипами токсичности. J. Steroid Biochem. Мол. Биол. 127 (1–2), 96–101. https://doi.org/10.1016/j.jsbmb.2010.12.005 (2011).

    CAS
    Статья
    PubMed

    Google Scholar

  • 38.

    Carreira, V. S. et al. Нарушение передачи сигналов рецептора Ah во время развития мышей приводит к аномальной структуре и функции сердца у взрослых. PLoS ONE 10 (11), e0142440. https://doi.org/10.1371/journal.pone.0142440 (2015).

    CAS
    Статья
    PubMed
    PubMed Central

    Google Scholar

  • 39.

    Carreira, V. S. et al. Передача сигналов рецептора Ah контролирует экспрессию генов сердечного развития и гомеостаза. Toxicol. Sci. 147 (2), 425–435. https://doi.org/10.1093/toxsci/kfv138 (2015).

    CAS
    Статья
    PubMed
    PubMed Central

    Google Scholar

  • 40.

    Ко, К. И. и Пуга, А. Регулирует ли арилуглеводородный рецептор плюрипотентность ?. Curr. Opin. Toxicol. 2 , 1–7. https://doi.org/10.1016/j.cotox.2017.01.004 (2017).

    Артикул
    PubMed
    PubMed Central

    Google Scholar

  • 41.

    Фернесс, С. Г., Лис, М. Дж. И Уайтлоу, М. Л. Рецептор диоксина (арилгидрокарбона) как модель адаптивных ответов факторов транскрипции bHLH / PAS. FEBS Lett. 581 (19), 3616–3625. https://doi.org/10.1016/j.febslet.2007.04.011 (2007).

    CAS
    Статья
    PubMed

    Google Scholar

  • 42.

    Puga, A., Ma, C. & Marlowe, J. L. Арилуглеводородный рецептор перекрестно взаимодействует с множественными путями передачи сигнала. Biochem. Pharmacol. 77 (4), 713–722. https://doi.org/10.1016/j.bcp.2008.08.031 (2009).

    CAS
    Статья
    PubMed

    Google Scholar

  • 43.

    Кинтана, Ф. Дж. Арилуглеводородный рецептор: молекулярный путь экологического контроля иммунного ответа. Иммунология 138 (3), 183–189.https://doi.org/10.1111/imm.12046 (2013).

    CAS
    Статья
    PubMed
    PubMed Central

    Google Scholar

  • 44.

    Thackaberry, EA, Nunez, BA, Ivnitski-Steele, ID, Friggins, M. & Walker, MK Влияние 2,3,7,8-тетрахлордибензо-p-диоксина на развитие сердца мыши: изменение в сердечный рост плода и послеродовой, а также постнатальная хронотропия сердца. Toxicol. Sci. 88 (1), 242–249.https://doi.org/10.1093/toxsci/kfi302 (2005).

    CAS
    Статья
    PubMed

    Google Scholar

  • 45.

    Mulero-Navarro, S. & Fernandez-Salguero, P.M. Новые тенденции в биологии рецепторов арилуглеводородов. Фронт. Cell Dev. Биол. 4 , 45. https://doi.org/10.3389/fcell.2016.00045 (2016).

    Артикул
    PubMed
    PubMed Central

    Google Scholar

  • 46.

    Fernandez-Salguero, P. et al. Нарушение иммунной системы и фиброз печени у мышей, лишенных рецептора Ah, связывающего диоксин. Наука 268 (5211), 722–726. https://doi.org/10.1126/science.7732381 (1995).

    ADS
    CAS
    Статья
    PubMed

    Google Scholar

  • 47.

    Шмидт, Дж. В., Су, Г. Х., Редди, Дж. К., Саймон, М. С. и Брэдфилд, С. А. Характеристика нулевого аллеля Ahr мыши: участие рецептора Ah в росте и развитии печени. Proc. Natl. Акад. Sci. СОЕДИНЕННЫЕ ШТАТЫ АМЕРИКИ. 93 (13), 6731–6736. https://doi.org/10.1073/pnas.93.13.6731 (1996).

    ADS
    CAS
    Статья
    PubMed

    Google Scholar

  • 48.

    Фернандес-Сальгуеро, П. М., Уорд, Дж. М., Сандберг, Дж. П. и Гонсалес, Ф. Дж. Поражения мышей с дефицитом арил-углеводородных рецепторов. Вет. Патол. 34 (6), 605–614. https://doi.org/10.1177/030098589703400609 (1997).

    CAS
    Статья
    PubMed

    Google Scholar

  • 49.

    Thomae, T. L., Glover, E. & Bradfield, C. A. Нулевой генотип Ahr по материнской линии делает эмбрионы чувствительными к химическому тератогенезу. J. Biol. Chem. 279 (29), 30189–30194. https://doi.org/10.1074/jbc.M4036 (2004 г.).

    CAS
    Статья
    PubMed

    Google Scholar

  • 50.

    Лахвис, Г.P. et al. Портосистемное шунтирование и стойкие сосудистые структуры плода у мышей с дефицитом арилуглеводородных рецепторов. Proc. Natl. Акад. Sci. СОЕДИНЕННЫЕ ШТАТЫ АМЕРИКИ. 97 (19), 10442–10447. https://doi.org/10.1073/pnas.1997 (2000).

    ADS
    CAS
    Статья
    PubMed

    Google Scholar

  • 51.

    Шмидт, Дж. В. и Брэдфилд, К. А. Пути передачи сигналов рецептора Ah. Annu. Rev. Cell Dev. Биол. 12 , 55–89. https://doi.org/10.1146/annurev.cellbio.12.1.55 (1996).

    CAS
    Статья
    PubMed

    Google Scholar

  • 52.

    Plavicki, J., Hofsteen, P., Peterson, R.E. & Heideman, W. Диоксин подавляет развитие эпикарда и проэпикарда у рыбок данио. Toxicol. Sci. 131 (2), 558–567. https://doi.org/10.1093/toxsci/kfs301 (2013).

    CAS
    Статья
    PubMed

    Google Scholar

  • 53.

    Уокер, М. К. и Катрон, Т. Ф. Характеристика кардиотоксичности, вызванной 2,3,7,8-тетрахлордибензо-п-диоксином и родственными химическими веществами во время раннего развития куриного эмбриона. Toxicol. Прил. Pharmacol. 167 (3), 210–221. https://doi.org/10.1006/taap.2000.8992 (2000).

    CAS
    Статья
    PubMed

    Google Scholar

  • 54.

    Копф, П. Г. и Уокер, М. К. Обзор пороков развития сердца, вызываемых диоксинами, полихлорированными бифенилами и пестицидами. J. Environ. Sci. Здоровье C Environ. Канцерогенный. Ecotoxicol. Ред. 27 (4), 276–285. https://doi.org/10.1080/1050195 (2009).

    CAS
    Статья
    PubMed

    Google Scholar

  • 55.

    Брунер-Тран, К. Л. и Остин, К. Г. Подверженность ТХДД развитию снижает фертильность и отрицательно влияет на исходы беременности в нескольких поколениях. Репродукция. Toxicol. 31 (3), 344–350.https://doi.org/10.1016/j.reprotox.2010.10.003 (2011).

    CAS
    Статья
    PubMed

    Google Scholar

  • 56.

    Кюль, К. С. и Лоффредо, К. А. Группа гипопластических пороков развития левых отделов сердца в Балтиморе, штат Мэриленд. Pediatr. Кардиол. 27 (1), 25–31. https://doi.org/10.1007/s00246-005-0859-x (2006).

    CAS
    Статья
    PubMed

    Google Scholar

  • 57.

    Ивницки-Стил, И. и Уокер, М. К. Ингибирование неоваскуляризации агентами окружающей среды. Cardiovasc. Toxicol. 5 (2), 215–226. https://doi.org/10.1385/ct:5:2:215 (2005).

    CAS
    Статья
    PubMed

    Google Scholar

  • 58.

    Gannon, M., Gilday, D. & Rifkind, A. B. TCDD индуцирует CYP1A4 и CYP1A5 в печени и почках цыплят и только CYP1A4, фермент, лишенный активности эпоксигеназы арахидоновой кислоты, в миокарде и эндотелии сосудов. Toxicol. Прил. Pharmacol. 164 (1), 24–37. https://doi.org/10.1006/taap.1999.8864 (2000).

    CAS
    Статья
    PubMed

    Google Scholar

  • 59.

    Гурди, Р. Г., Кубалак, С. и Микава, Т. Проведение эмбрионального сердца: управление развитием специализированных сердечных тканей. Trends Cardiovasc. Med. 9 (1–2), 18–26. https://doi.org/10.1016/s1050-1738(98)00035-8 (1999).

    CAS
    Статья
    PubMed

    Google Scholar

  • 60.

    Национальная токсикологическая программа. 2,3,7,8-Тетрахлордибензо-п-диоксин. Rep. Carcinog . 12 , 396–398 (2011).

  • 61.

    Weber, H. & Birnbaum, LS 2,3,7,8-Тетрахлордибензо-п-диоксин (TCDD) и 2,3,7,8-тетрахлордибензофуран (TCDF) у беременных мышей C57BL / 6N: распространение на эмбрион и выделение. Arch. Toxicol. 57 (3), 159–162.https://doi.org/10.1007/bf002

    (1985).

    CAS
    Статья
    PubMed

    Google Scholar

  • 62.

    ДеВито, М. Дж., Бирнбаум, Л. С., Фарланд, В. Х. и Гасевич, Т. А. Сравнения расчетной нагрузки на организм человека диоксиноподобными химическими веществами и нагрузки на организм ТХДД у животных, подвергшихся экспериментальному воздействию. Environ Health Perspect. 103 (9), 820–831. https://doi.org/10.1289/ehp.95103820 (1995).

    CAS
    Статья
    PubMed
    PubMed Central

    Google Scholar

  • 63.

    Srinivasan, S. et al. Неинвазивная визуализация внутриутробного развития эмбрионального сердца мыши с помощью эхокардиографии с частотой 40 МГц. Тираж 98 (9), 912–918. https://doi.org/10.1161/01.cir.98.9.912 (1998).

    CAS
    Статья
    PubMed

    Google Scholar

  • 64.

    Rubinstein, J. et al. Новая роль временного рецепторного потенциала ваниллоида 2 в регуляции сердечной деятельности. Am. J. Physiol. Heart Circ. Physiol. 306 (4), H574 – H584. https://doi.org/10.1152/ajpheart.00854.2013 (2014).

    CAS
    Статья
    PubMed

    Google Scholar

  • 65.

    Шредер, Э., Мадьяр, Дж., Берджесс, Д., Андрес, Д. и Сатин, Дж. Хроническое лечение верапамилом ремоделирует ICa, L в желудочке мыши. Am. J. Physiol. Heart Circ. Physiol. 292 (4), h2906 – h2916. https://doi.org/10.1152 / ajpheart.00793.2006 (2007).

    CAS
    Статья
    PubMed

    Google Scholar

  • 66.

    Koch, S.E. et al. Траниласт притупляет гипертрофический и фиброзный ответ на повышенную постнагрузку независимо от транзиторного рецепторного потенциала кардиомиоцитов ваниллоидных 2 каналов. J. Cardiovasc. Pharmacol. 72 (1), 40–48. https://doi.org/10.1097/fjc.0000000000000588 (2018).

    CAS
    Статья
    PubMed
    PubMed Central

    Google Scholar

  • 67.

    Koch, S.E. et al. Транзиторная функция ваниллоида 2 рецепторного потенциала регулирует сердечную гипертрофию посредством активации, индуцированной растяжением. J. Hypertens. 35 (3), 602–611. https://doi.org/10.1097/hjh.0000000000001213 (2017).

    CAS
    Статья
    PubMed

    Google Scholar

  • 68.

    Lerman, I. et al. Генетическая изменчивость выполнения принудительных и произвольных упражнений на выносливость у семи инбредных линий мышей. J. Appl. Physiol. (1985) 92 (6), 2245–2255. https://doi.org/10.1152/japplphysiol.01045.2001 (2002).

    Артикул

    Google Scholar

  • 69.

    Naticchioni, M. et al. Транзиторный рецепторный потенциал ваниллоида 2 регулирует реакцию миокарда на физическую нагрузку. PLoS ONE 10 (9), e0136901. https://doi.org/10.1371/journal.pone.0136901 (2015).

    CAS
    Статья
    PubMed
    PubMed Central

    Google Scholar

  • 70.

    Fan, L., Ovadia, M., Friedman, DM & Rifkind, AB. Предвозбуждение желудочков, чувствительное к флекаиниду, на поздних стадиях ЭКГ куриного эмбриона: 2,3,7,8-тетрахлордибензо-п-диоксин нарушает инотропные, но не хронотропные или дромотропные свойства. реагирует на изопротеренол и придает устойчивость к флекаиниду. Toxicol. Прил. Pharmacol. 166 (1), 43–50. https://doi.org/10.1006/taap.2000.8948 (2000).

    CAS
    Статья
    PubMed

    Google Scholar

  • 71.

    Sommer, R.J. et al. Воздействие 2,3,7,8-тетрахлордибензо-п-диоксина на раннем этапе развития снижает хронотропный ответ сердца куриного эмбриона на изопротеренол, но не на агенты, влияющие на сигналы ниже бета-адренорецептора. Toxicol. Sci. 83 (2), 363–371. https://doi.org/10.1093/toxsci/kfi041 (2005).

    CAS
    Статья
    PubMed

    Google Scholar

  • 72.

    Fujisawa, N., Tohyama, C. & Yoshioka, W. Кардиотоксичность, вызванная воздействием 2,3,7,8-тетрахлордибензо-п-диоксина на мышей во время лактации. J. Toxicol. Sci. 44 (7), 505–513. https://doi.org/10.2131/jts.44.505 (2019).

    CAS
    Статья
    PubMed

    Google Scholar

  • 73.

    Kopf, P. G., Huwe, J. K. & Walker, M. K. Гипертензия, гипертрофия сердца и нарушение расслабления сосудов, вызванные 2,3,7,8-тетрахлордибензо-пара-диоксином, связаны с повышенным содержанием супероксида. Cardiovasc. Toxicol. 8 (4), 181–193. https://doi.org/10.1007/s12012-008-9027-x (2008).

    CAS
    Статья
    PubMed
    PubMed Central

    Google Scholar

  • 74.

    де Бур, Б. А., ван ден Берг, Г., де Бур, П. А., Мурман, А. Ф. и Руйтер, Дж. М. Рост развивающегося сердца мыши: интерактивный качественный и количественный трехмерный атлас. Dev. Биол. 368 (2), 203–213. https: // doi.org / 10.1016 / j.ydbio.2012.05.001 (2012).

    CAS
    Статья
    PubMed

    Google Scholar

  • 75.

    Мимура, Дж., Эма, М., Согава, К. и Фуджи-Курияма, Ю. Идентификация нового механизма регуляции функции рецептора Ah (диоксина). Genes Dev. 13 (1), 20–25. https://doi.org/10.1101/gad.13.1.20 (1999).

    CAS
    Статья
    PubMed
    PubMed Central

    Google Scholar

  • 76.

    Vogel, C. F. et al. Трансгенная сверхэкспрессия репрессора арилуглеводородного рецептора (AhRR) и AhR-опосредованная индукция CYP1A1, цитокинов и острая токсичность. Environ. Перспектива здоровья. 124 (7), 1071–1083. https://doi.org/10.1289/ehp.1510194 (2016).

    CAS
    Статья
    PubMed
    PubMed Central

    Google Scholar

  • 77.

    Vogel, C. F. A. et al. Защитная роль репрессора арилуглеводородных рецепторов при воспалении и росте опухолей. Раки (Базель) https://doi.org/10.3390/cancers11050589 (2019).

    Артикул

    Google Scholar

  • 78.

    Джадж, С. и Лиувенбург, К. Митохондриальная биоэнергетика сердца, окислительный стресс и старение. Am. J. Physiol. Cell Physiol. 292 (6), C1983 – C1992. https://doi.org/10.1152/ajpcell.00285.2006 (2007).

    CAS
    Статья
    PubMed

    Google Scholar

  • 79.

    Pham The, T. et al. Влияние перинатального воздействия диоксина на обучаемость 8-летних детей во Вьетнаме. Внутр. J. Hyg. Environ. Здоровье. 223 (1), 132–141. https://doi.org/10.1016/j.ijheh.2019.09.010 (2020).

    CAS
    Статья
    PubMed

    Google Scholar

  • 80.

    Вогли, К., Эссер, К., Тютинг, Т., Крутманн, Дж. И Хаарманн-Стемманн, Т. Роль арилуглеводородного рецептора в вызываемом окружающей средой старении кожи и канцерогенезе кожи. Внутр. J. Mol. Sci. https://doi.org/10.3390/ijms20236005 (2019).

    Артикул
    PubMed
    PubMed Central

    Google Scholar

  • 81.

    Гаринис, Г. А., ван дер Хорст, Г. Т., Видж, Дж. И Хоймейкерс, Дж. Х. Повреждение ДНК и старение: идеи нового века для решения вековой проблемы. Nat. Cell Biol. 10 (11), 1241–1247. https://doi.org/10.1038/ncb1108-1241 (2008).

    CAS
    Статья
    PubMed
    PubMed Central

    Google Scholar

  • 82.

    Гредилла Р., Бор В. А. и Стевнснер Т. Восстановление митохондриальной ДНК и связь со старением – обновленная информация. Exp. Геронтол. 45 (7–8), 478–488. https://doi.org/10.1016/j.exger.2010.01.017 (2010).

    CAS
    Статья
    PubMed
    PubMed Central

    Google Scholar

  • 83.

    Myburgh, K.H. Что делает спортсмена на выносливость мирового класса? Не просто физиологическая головоломка. Комп. Biochem. Physiol.Мол. Интегр. Physiol. 136 (1), 171–190. https://doi.org/10.1016/s1095-6433(03)00220-4 (2003).

    Артикул
    PubMed

    Google Scholar

  • 84.

    Vijay, V. et al. Половой диморфизм в экспрессии генов, связанных с митохондриями, в сердце крыс в разном возрасте. PLoS ONE 10 (1), e0117047. https://doi.org/10.1371/journal.pone.0117047 (2015).

    CAS
    Статья
    PubMed
    PubMed Central

    Google Scholar

  • 85.

    Нембхард В. Н., Ван Т., Лоскальцо М. Л. и Салеми Дж. Л. Различия в распространенности врожденных пороков сердца в зависимости от расы / этнической принадлежности матери и пола ребенка. J. Pediatr. 156 (2), 259–264. https://doi.org/10.1016/j.jpeds.2009.07.058 (2010).

    Артикул
    PubMed

    Google Scholar

  • 86.

    Арагон, А. К., Гоенс, М. Б., Карбетт, Э. и Уокер, М. К. Перинатальное воздействие 2,3,7,8-тетрахлордибензо-п-диоксина повышает чувствительность потомства к гипертонии, индуцированной ангиотензином II. Cardiovasc. Toxicol. 8 (3), 145–154. https://doi.org/10.1007/s12012-008-9023-1 (2008).

    CAS
    Статья
    PubMed
    PubMed Central

    Google Scholar

  • 87.

    Bridgman, P. et al. Гендерные паттерны ремоделирования левого желудочка и миоцитов после инфаркта миокарда у мышей с дефицитом рецептора ангиотензина II типа 1a. Am. J. Physiol. Heart Circ. Physiol. 289 (2), H586 – H592. https://doi.org/10.1152/ajpheart.00474.2004 (2005 г.).

    CAS
    Статья
    PubMed

    Google Scholar

  • 88.

    Ichihara, S. et al. Удаление арилуглеводородного рецептора способствует индуцированному ангиотензином II сердечному фиброзу за счет усиления передачи сигналов c-Jun / HIF-1α. Arch. Toxicol. 93 (6), 1543–1553. https://doi.org/10.1007/s00204-019-02446-1 (2019).

    CAS
    Статья
    PubMed
    PubMed Central

    Google Scholar

  • 89.

    Zhang, N. et al. Активированная ренин-ангиотензиновая система поддерживает нормальное кровяное давление у мышей, гетерозиготных по арилуглеводородным рецепторам, но не у нулевых мышей. Biochem. Pharmacol. 80 (2), 197–204. https://doi.org/10.1016/j.bcp.2010.03.023 (2010).

    CAS
    Статья
    PubMed
    PubMed Central

    Google Scholar

  • 90.

    Hsu, C. N. et al. Добавка триптофана для матери защищает потомство взрослых крыс от гипертонии, запрограммированной хроническим заболеванием почек у матери: влияние микробиома, метаболизирующего триптофан, и рецептора арилуглеводородов. Внутр. J. Mol. Sci. https://doi.org/10.3390/ijms21124552 (2020).

    Артикул
    PubMed
    PubMed Central

    Google Scholar

  • Доказательства того, что ингибирование образования зачатка эпителия предстательной железы у фетальных мышей C57BL / 6J, подвергшихся воздействию 2,3,7,8-тетрахлордибензо-p-диоксина, не связано с нарушением передачи сигналов андрогенов в урогенитальном синусе | Токсикологические науки

    Аннотация

    2,3,7,8-Тетрахлордибензо- p -диоксин (TCDD) ингибирует андроген-зависимые процессы, посредством которых урогенитальный синус (UGS) плодных мышей формирует зачатки эпителия предстательной железы.Это ингибирование опосредуется рецепторами арилуглеводородов в мезенхиме UGS и вызывает аномальное развитие долей простаты. Были проведены эксперименты для проверки гипотезы о том, что TCDD ингибирует образование почки простаты у мышей C57BL / 6J путем ингибирования передачи сигналов андрогенов. In utero Воздействие TCDD, достаточное для подавления бутонизации (доза 5 мкг / кг для матери в день беременности [GD] 13), не влияло на содержание тестостерона в яичках на GD 16 или 18. Оно также не ингибировало превращение тестостерона в 5α-дигидротестостерон. (DHT) ПХГ.И гидроксифлутамид (ОН-флутамид; конкурентный антагонист андрогеновых рецепторов), и TCDD ингибировали зарастание эпителия предстательной железы с помощью UGS, культивированных in vitro с DHT. Чтобы определить, ингибирует ли TCDD чувствительность к андрогенам, первичные мезенхимальные клетки, полученные из UGS, культивированных в течение трех дней с DHT, временно трансфицировали андроген-чувствительной репортерной плазмидой (MMTV-люцифераза). ОН-флутамид предотвращал повышение активности люциферазы ДГТ в этих клетках, а ТХДД – нет.Такие же результаты были получены, когда мезенхимальные клетки были выделены из UGS, культивированных как с DHT, так и с TCDD. Отсутствие эффекта TCDD на андроген-зависимую экспрессию генов не было связано с неспособностью трансфицированных мезенхимальных клеток UGS отвечать на TCDD, о чем свидетельствует значительное увеличение активности люциферазы после трансфекции плазмидами, содержащими промоторы CYP1A1 и CYP1B1. Наконец, в то время как ОН-флутамид предотвращал изменение DHT рецептора андрогена и экспрессии мРНК 5α-редуктазы типа II в культуре органов UGS, TCDD не оказывал таких эффектов.В совокупности эти результаты предполагают, что TCDD ингибирует образование зачатков эпителия предстательной железы без нарушения сигнального пути рецептора андрогенов.

    2,3,7,8-тетрахлордибензо- p -диоксин (TCDD), урогенитальный синус (UGS), образование зачатка эпителия предстательной железы, культура мезенхимных клеток первичной UGS, развитие, путь передачи сигналов рецептора андрогенов, плод мыши C57BL / 6J, простата , hydroxyflutamide

    Первым морфологическим этапом развития простаты является прорастание зачатков эпителия урогенитального синуса (UGS) в окружающую мезенхиму UGS.Формирование зачатка эпителия предстательной железы и последующее развитие предстательной железы являются андроген-зависимыми процессами. Это развитие опосредуется рецепторами андрогенов (AR), которые присутствуют в мезенхиме UGS во время пренатального развития, но отсутствуют в эпителии UGS. И мезенхима, и эпителий содержат 5α-редуктазу, которая превращает тестостерон в более мощный андрогенный 5α-дигидротестостерон (DHT). DHT стимулирует мезенхиму UGS, чтобы вызвать развитие эпителиальных зачатков предстательной железы, которые впоследствии удлиняются, канализируются, разветвляются и, в конечном итоге, образуют эпителий простаты (Bard et al., 1979; Cooke et al. , 1991; Кунья и Лунг, 1978; Ласницки и Мизуно, 1977, 1980; Timms et al. , 1994).

    Прерывание передачи сигналов андрогенов, например, при воздействии in utero ингибитора 5α-редуктазы финастерида или конкурентного антиандрогенного флутамида, может ингибировать образование зачатков простаты у крыс (Hib and Ponzio, 1995). Аналогичным образом, in utero, воздействие ингибитора 5α-редуктазы 6-метилен-4-прегнен-3,20-диона ингибирует образование зачатков эпителия предстательной железы у мышей (Iguchi et al., 1991). Передача сигналов андрогенов также может быть прервана мутациями, которые делают AR нефункциональной (Brown et al. , 1990; Quigley et al. , 1992; Thiele et al. , 1999) или мутациями в 5α-редуктазе ( Махендру и Рассел, 1999). Такие мутации вызывают аномалии простаты или агенезию, а также множество других изменений в половом развитии человека (Griffin et al. , 1995). Коактиваторы и корегуляторы AR также важны для передачи сигналов андрогенов.Например, дефицит коактиватора стероидных рецепторов (SRC-1) подавляет рост и развитие простаты (Xu et al. , 1998), а доминантно-отрицательный мутант корегулятора AR ARA54 ингибирует пролиферацию клеток андроген-зависимого рака простаты (Miyamoto et al. al. , 2002).

    Развитие вентральной, дорсолатеральной и передней предстательной железы у мышей C57BL / 6 ингибируется in utero и воздействием лактационного TCDD (Ko et al., , 2002; Lin et al., 2002a). Эти эффекты опосредуются рецептором TCDD, рецептором арилуглеводородов (AHR; Carlson and Perdew, 2002; Gasiewicz and Park, 2003), о чем свидетельствует отсутствие ингибирования роста простаты у мышей Ahr , нокаутированных по TCDD ( Lin и др. , 2002a). Природа и тяжесть эффектов TCDD на мышей дикого типа варьируются от доли к доле, но наиболее сильно поражается вентральная простата (Ko et al. , 2002; Lin et al. , 2002a).Критический период воздействия TCDD включает или наступает в основном в течение in utero развития (Lin et al. , 2002b). TCDD подавляет развитие простаты в отсутствие какого-либо устойчивого снижения постнатальных концентраций андрогенов в плазме или постнатального содержания андрогенов в яичках (Ko et al. , 2002; Lin et al. , 2002a).

    У мышей C57BL / 6J, внутриутробно. Воздействие TCDD может вызвать полное отсутствие зачатков эпителия предстательной железы на вентральной поверхности UGS (Lin et al., 2003). Неспособность этих зачатков сформироваться объясняет полный агенез вентральных основных протоков простаты у мышей, подвергшихся воздействию TCDD (Ko et al. , 2002). Количество дорсолатеральных эпителиальных зачатков предстательной железы также снижается на in utero, воздействие TCDD (Lin et al. , 2003), что объясняет уменьшение количества дорсальных и боковых основных протоков простаты (Ko et al. , 2002). ). Подавление образования эпителиальных зачатков предстательной железы, по-видимому, вызвано в первую очередь прямым действием TCDD на UGS (Lin et al., в печати) и опосредуется AHR в мезенхиме UGS, а не в эпителии UGS (Ko et al. , в печати).

    Основные механизмы, с помощью которых воздействие TCDD ингибирует образование зачатков эпителия предстательной железы во время беременности, неизвестны. Интересная возможность заключается в том, что ингибирование образования зачатков эпителия предстательной железы является результатом ингибирования передачи сигналов андрогенов в мезенхимальных клетках UGS. Неизвестно, связывается ли TCDD с AR, но механизмы, которые, как предполагается, участвуют в способности TCDD ингибировать передачу сигналов андрогенов в других экспериментальных системах, включают (1) снижение экспрессии гена AR (Ohsako et al., 2001; Theobald et al. , 2000), (2) конкуренция между AR и AHR за коактиваторы, такие как RIP140 и SRC-1 (Kumar and Perdew, 1999; Kumar et al. , 1999), и (3) прямое взаимодействие активированного AHR с андрогеном. реагирующие элементы (Jana et al. , 1999).

    Целью настоящего исследования было определить, является ли индуцированное TCDD ингибирование образования зачатка эпителия предстательной железы с помощью UGS результатом ингибирования передачи сигналов андрогенов или эффектов TCDD, которые могут быть независимыми от андрогенов.Уровни андрогенов и метаболизм исследовались пренатально. Первичные мезенхимальные клетки UGS, временно трансфицированные андроген-чувствительным репортерным геном, использовали для оценки эффектов TCDD на передачу сигналов андрогенов. Влияние TCDD на регулируемую андрогеном экспрессию генов AR и 5α-редуктазы II типа также исследовали в UGS. Полученные данные свидетельствуют о том, что TCDD ингибирует образование зачатков эпителия предстательной железы с помощью механизма, который не включает снижение андрогенной стимуляции UGS или ингибирование сигнальных путей AR в UGS.

    МАТЕРИАЛЫ И МЕТОДЫ

    Животные.

    мышей C57BL / 6J были получены из лаборатории Джексона, Бар-Харбор, штат Мэн, и содержались в контролируемой среде с 12-часовым циклом свет-темнота (свет с 06:00 до 18:00), комнатной температурой 22 ± 1 ° C и влажностью 35 ± 5%. Мышей содержали в прозрачных пластиковых клетках с подстилкой из термообработанной осиновой стружки. Корм для мышей (5015 Mouse Diet, PMI Nutrition International, Брентвуд, Миссури) и водопроводная вода были доступны ad libitum.

    Для получения беременных самок, рассчитанных на определенное время, группы из трех самок в возрасте 90–120 дней были размещены на ночь по одному самцу в клетке. Беременным самкам вводили однократную дозу либо носителя (95% кукурузного масла / 5% ацетона, об. / Об.), Либо 5 мкг ТХДД / кг через желудочный зонд в день беременности (GD) 13. Самок подвергали эвтаназии передозировкой CO 2 , поэтому Ткань UGS могла быть получена от плодов мужского пола. Все процедуры с животными проводились в соответствии с протоколами, утвержденными Комитетом по уходу и использованию животных Университета Висконсин-Мэдисон.

    Содержание тестостерона в яичках.

    Стероиды экстрагировали из семенников этилацетатом. Органические фазы упаривали досуха в слабом потоке азота и восстанавливали в 100% этаноле. Содержание тестостерона в яичках измеряли с помощью иммуноферментного анализа в соответствии с протоколом поставщика набора (Assay Designs, Inc., Ann Arbor, MI). Диапазон анализа составлял 7,8–2000 пг тестостерона / мл.

    In vitro органная культура ПХГ.

    плодов GD 14 вырезали из подвергнутых эвтаназии маток, немедленно помещали на лед и определяли пол путем осмотра гонад. UGS был вырезан из плодов мужского пола после удаления мочевого пузыря, Вольфовых протоков и остатков Мюллерова протоков. Выделенные UGS помещали в 500 мкл 0,6% агарозы SeaPlaque в среде Игла, модифицированной Дульбекко (DMEM) с добавлением 5% фетальной бычьей сыворотки, очищенной от угля и декстрана (CD-FBS; Hyclone, Logan, UT) и 1% антибиотиков-антимикотиков ( Gibco BRL, Гранд-Айленд, штат Нью-Йорк).После добавления этих компонентов гели агарозы затвердевали при 4 ° C в течение 10 мин, затем к гелю агарозы добавляли 500 мкл DMEM / 5% CD-FBS с 1% антибиотиками-антимикотиками. Культивированные UGS подвергались воздействию 0,1% (об. / Об.) Этанола, 10 -8 M DHT или 10 -8 M DHT + 10 -5 M гидроксифлутамида (OH-флутамида), подаренного Dr C. Tendler (Procter and Gamble Co., Цинциннати, Огайо), или 10 −8 M DHT + 10 −9 M TCDD. Культуры органов UGS поддерживали в течение трех дней (GD 14–16) или пяти дней (GD 14–18) в увлажненном инкубаторе при 37 ° C, 5% CO 2 /95%, а культуральную среду заменяли каждые 48 час

    Подсчет почек и сканирующая электронная микроскопия.

    После культивирования in vitro каждый UGS собирали и сохраняли отдельно в сбалансированном солевом растворе Хэнкса, не содержащем кальция и магния (HBSS; Sigma Chemical Co., Сент-Луис, Миссури), чтобы мезенхиму можно было отделить от эпителия. Мезенхиму ферментативно диссоциировали от эпителия в растворе 1% трипсина (Difco, Sparks, MD) в HBSS в течение 90 мин при 4 ° C с последующей осторожной механической обработкой тонкими пинцетами.Изолированный эпителий UGS фиксировали в 2,5% глутаровом альдегиде, затем подсчитывали почки под световым микроскопом при приблизительно 40-кратном увеличении, фокусируя образец вверх и вниз в каждой из нескольких ориентаций. ПХГ с более чем 10 бутонами подсчитывали не менее двух раз. Затем устанавливали UGS и оценивали с помощью сканирующей электронной микроскопии, как описано ранее (Lin et al. , 2003).

    Радиоактивно меченные метаболиты тестостерона в культуральной среде для органов UGS.

    UGS, полученных от плодов мужского пола, подвергшихся воздействию носителя и TCDD, на GD 16, немедленно помещали в DMEM (Gibco BRL) с 5% CD-FBS. ПХГ культивировали при 37 ° C в атмосфере 95% воздуха и 5% диоксида углерода в присутствии 10 –8 M [1,2,6,7– 3 H] -тестостерона (Amersham, Arlington Heights , Иллинойс). Через 24 и 48 ч среду удаляли и хранили при -20 ° C перед экстракцией растворителем и тонкослойным хроматографическим анализом радиоактивно меченных метаболитов тестостерона, как описано ранее (Theobald et al., 2000).

    Получение первичных мезенхимальных клеток UGS.

    После культивирования in vitro в течение трех дней UGS частично переваривали трипсином, как описано выше. Затем из мезенхимы удаляли эпителий, раздирая ткани тонкими щипцами. Мезенхимы инкубировали в 1% коллагеназе (Sigma) в HBSS при 37 ° C в течение 30 минут с последующей инкубацией в 0,1% ДНКазе (Sigma) в HBSS при 37 ° C в течение 10 минут. Суспензии единичных клеток получали осторожным пипетированием обработанной ткани.Суспензии клеток центрифугировали при 2500 × g в течение 2 минут при комнатной температуре и дважды промывали DMEM с добавлением 5% CD-FBS. Изолированные первичные мезенхимальные клетки UGS культивировали в среде DMEM с добавлением 5% CD-FBS.

    Первичная культура мезенхимальных клеток UGS и временная трансфекция.

    Первичные мезенхимные клетки UGS высевали в 96-луночные планшеты из расчета 5 × 10 4 клеток / лунку и трансфицировали методом соосаждения фосфатом кальция (Moehlenkamp and Johnson, 1999).Клетки трансфицировали 30 нг андроген-чувствительной репортерной плазмиды, репортерной плазмиды люциферазы вируса опухоли молочной железы мыши (MMTV-люцифераза) или TCDD-чувствительной репортерной плазмиды. Плазмида MMTV-люцифераза была подарком д-ра А. О. Бринкманна (Медицинский центр Университета Эразма, Роттердам, Нидерланды). TCDD-чувствительные репортерные плазмиды pGud1.1-Luc (содержащие промотор цитохрома P4501A1 мыши) и pCYP1B1-Luc (содержащие промотор цитохрома P4501B1 мыши) были предоставлены Drs.М. С. Денисон (Калифорнийский университет, Дэвис, Калифорния) и К. Р. Джефкоат (Висконсинский университет, Мэдисон, Висконсин), соответственно. Плазмиду CMVβ-gal (2 нг / лунку) использовали для корректировки эффективности трансфекции. Для андроген-чувствительного репортерного анализа клетки обрабатывали в течение 12 часов 0,1% этанолом (носитель для DHT и OH-флутамида) и 0,1% ДМСО (носитель для TCDD), 10 -8 M DHT, 10 -8 M DHT + 10 −5 M OH-флутамид или 10 −8 M DHT + 10 −9 M TCDD.Для анализа TCDD-чувствительного репортера клетки обрабатывали в течение 12 часов ДМСО (конечная концентрация 0,1%) или 10 -9 M TCDD + 10 -8 M DHT. Клетки лизировали в 100 мкл буфера для экстракции белка (100 мМ KPO 4 , pH 7,4, 1,5 мМ MgSO 4 , 1,0 мМ дитиотреитол и 0,1% Triton X-100) + 4,0 мМ АТФ. Люциферазную активность определяли добавлением 210 мкл буфера для анализа люциферазы (100 мМ KPO 4 , pH 7,4, 4,0 мМ АТФ и 1,5 мМ MgSO 4 ) к 30 мкл клеточного лизата на лунку (Ahlgren-Beckendorf et al. ., 1999). Люминесценцию определяли с использованием люминометра для микротитрационных планшетов ML2250 (Dynatech Laboratories, Шантильи, Вирджиния). Активность β-галактозидазы измеряли с помощью хемилюминесцентного репортерного анализа Galacto-Light (Applied Biosystems, Foster City, CA). Клеточные лизаты (30 мкл) добавляли к 200 мкл реакционного буфера β-галактозидазы (100 мМ фосфата натрия, pH 8,0, 1 мМ MgCl 2 , 0,1 М β-меркаптоэтанола и 0,6 мкг o -нитрофенил-β -галактозид на мл). Данные выражены в виде отношения активности люциферазы к активности β-галактозидазы, измеренной в отдельных аликвотах клеточного лизата из каждой лунки.

    Количественная оценка мРНК ОТ-ПЦР в реальном времени.

    Суммарную РНК

    получали из культивированных in vitro UGS с использованием RNeasy Mini Kits (Qiagen, Valencia, CA) в соответствии с инструкциями производителя. Синтез кДНК проводили с использованием обратной транскриптазы Omniscript (Qiagen) в 20 мкл реакционных пробирках, содержащих 250 нг общей РНК, в соответствии с протоколом производителя. Затем образцы анализировали с помощью ОТ-ПЦР в реальном времени с использованием системы GeneAmp 5700 (PE Biosystems, Foster City, CA).Реакцию проводили в конечном объеме 20 мкл: 10 мкл SYBR Green, 1 мкл 5 мкМ прямого праймера, 1 мкл 5 мкМ обратного праймера, 1 мкл матрицы (кДНК) и 7 мкл деионизированной воды. Последовательности праймеров, размеры продуктов и температуры отжига показаны в таблице 1. Анализ проводили на пяти образцах в каждой группе обработки в трех экземплярах. ПЦР выполняли в течение 40 циклов, каждый из которых состоял из 1 мин денатурации при 95 ° C, 1 мин отжига при соответствующей температуре для каждого гена и 2 мин удлинения при 72 ° C.В конце цикла ПЦР строили кривую плавления, чтобы проверить наличие одного ампликона. Амплифицированный продукт ПЦР анализировали с использованием программного обеспечения GeneAmp 5700 (PE Biosystems).

    Статистический анализ.

    Сравнение между двумя группами лечения проводилось с помощью теста Стьюдента t , когда были выполнены соответствующие допущения, или с помощью теста Вилкоксона-Манна-Уитни, когда необходимо. Непараметрический критерий k-выборок Краскела-Уоллиса использовался для оценки значимых различий, когда присутствовало более двух групп лечения и допущения, необходимые для параметрического дисперсионного анализа, не выполнялись.Впоследствии для определения наличия значимых различий между отдельными группами лечения использовались защищенный тест Фишера на наименьшее значимое различие или критерии Вилкоксона-Манна-Уитни. Статистический анализ проводился с использованием пакета программ Statistica 5.0. Все результаты представлены как среднее ± стандартная ошибка. Значимость была установлена ​​на уровне p <0,05.

    РЕЗУЛЬТАТЫ

    Влияние воздействия

    In Utero TCDD на содержание тестостерона в яичках и на превращение тестостерона в 5α-дигидротестостерон с помощью UGS

    Чтобы определить, влияет ли in utero TCDD на содержание тестостерона в семенниках у плодных мышей, самкам давали однократную пероральную дозу носителя или TCDD (5 мкг / кг) на GD 13.Содержание тестостерона у плодов, подвергшихся воздействию носителя, составляло в среднем около 800 и 1400 пг / яичко на GD 16 и 18 соответственно (рис. 1). In utero Воздействие TCDD не оказало значительного влияния на содержание тестостерона в яичках в любое время.

    UGS, полученных от плодных мышей на GD 16, через три дня после введения материнской дозе носителя или 5 мкг TCDD / кг, инкубировали in vitro с [ 3 H] -тестостероном. Через 24 или 48 ч радиоактивно меченные стероиды экстрагировали из культуральной среды и разделяли с помощью тонкослойной хроматографии.По существу, вся радиоактивность была обнаружена в четырех пиках, идентифицированных как тестостерон, DHT, 5α-андростан-3α, 17β-диол и 5α-андростан-13,17-дион. In utero Воздействие TCDD не оказало значительного влияния на концентрацию тестостерона или трех его основных метаболитов через 24 часа (рис. 2A) или 48 часов после культивирования in vitro (рис. 2B).

    Эти результаты убедительно свидетельствуют о том, что воздействие in utero TCDD не изменяет доступность тестостерона для UGS и формирующейся предстательной железы, а также не ингибирует превращение тестостерона в DHT в UGS при формировании зачатков эпителия предстательной железы.

    Влияние ОН-флутамида и TCDD на формирование зачатков эпителия предстательной железы in vitro

    Способность чистого антиандрогена ОН-флутамида блокировать DHT-индуцированное образование эпителиальных зачатков предстательной железы in vitro была протестирована и сравнена с эффектами TCDD. Как и ожидалось, не было обнаружено зачатков предстательной железы, когда мужские UGS, полученные на GD 14, культивировали без DHT в течение пяти дней (группа носителя, фиг. 3 и 4). UGS, культивированные с 10 -8 M DHT, в среднем составляли около 20 зачатков предстательной железы после пяти дней культивирования (рис.4), распределенные по их вентральной, дорсолатеральной и передней поверхности (рис. 3). Когда UGS культивировали с DHT и 10 -5 M OH-флутамидом, в среднем только около четырех зачатков предстательной железы (рис. 4) были обнаружены на комбинированных вентральной, дорсолатеральной и передней поверхностях (рис. 3). UGS, культивированные с DHT и 10 -9 M TCDD, в среднем составляли около шести простатических зачатков (рис. 4). Торможение почкования с помощью TCDD оказалось более сильным на вентральной поверхности, чем на остальных поверхностях (рис.3), но не было получено убедительных доказательств значительного различия в паттернах почкования между ОН-флутамидом и TCDD.

    Влияние OH-флутамида и TCDD на андроген-зависимую люциферазную активность в первичных культурах мезенхимных клеток UGS

    Чтобы определить, подавляет ли TCDD способность мезенхимы UGS отвечать на андрогенную стимуляцию, исследовали эффекты OH-флутамида и TCDD на индуцированную DHT транскрипционную активность. GD 14 UGS культивировали in vitro в течение трех дней с 10 -8 M DHT и либо 0.1% ДМСО или 10 -9 М ТХДД. Первичные мезенхимные клетки, полученные из этих культур, временно трансфицировали андроген-чувствительной репортерной плазмидой MMTV-люциферазы с последующей обработкой носителем, 10 -8 M DHT, DHT + 10 -5 M OH-флутамидом или DHT + 10 −9 млн TCDD. Через 12 ч измеряли активность люциферазы.

    Когда мезенхимальные клетки были выделены из UGS, которые культивировались с DHT, но не с TCDD, инкубация без DHT приводила к низкой активности люциферазы (рис.5А). ДГТ увеличивал активность люциферазы примерно в шесть раз; ОН-флутамид снижает активность люциферазы, индуцированную ДГТ, до фонового уровня; и TCDD не влиял на DHT-индуцированную активность люциферазы (фиг. 5A).

    Когда мезенхимные клетки были выделены из UGS, которые культивировались как с DHT, так и с TCDD в течение трех дней, затем трансфицированы плазмидой MMTV-люциферазы и инкубированы в течение 12 часов, наблюдалась практически такая же картина эффектов. Активность люциферазы была низкой в ​​клетках без DHT или в клетках, инкубированных как с DHT, так и с OH-флутамидом, высокая активность люциферазы в клетках, инкубированных только с DHT, и отсутствие ингибирования TCDD индуцированной DHT активности люциферазы (рис.5Б).

    Эти эксперименты демонстрируют, что TCDD, в отличие от ОН-флутамида, не является антиандрогенным в этой экспериментальной системе после острого воздействия (12 часов первичной культуры мезенхимальных клеток UGS) или хронического воздействия (три дня культивирования органов UGS плюс 12 часов мезенхимальных клеток UGS). культура клеток).

    AhR-зависимая активность люциферазы в мезенхимальных клетках UGS

    Чтобы определить, было ли отсутствие эффекта TCDD на передачу сигналов андрогенов первичными мезенхимальными клетками UGS из-за неспособности этих клеток отвечать на TCDD, первичные мезенхимные клетки UGS были трансфицированы TCDD-чувствительными репортерными плазмидами люциферазы, содержащими либо CYP1A1, либо CYP1B1. промоутер (Garrison, 1996; Zhang et al., 1998). Эти клетки получали из GD 14 UGS, которые культивировали in vitro с 10 -8 М DHT в течение трех дней. Затем первичные мезенхимные клетки трансфицировали репортерными плазмидами и инкубировали в течение 12 часов с 10 -8 М DHT и либо 0,1% ДМСО, либо 10 -9 М TCDD. TCDD увеличивал активность люциферазы примерно в 1,7 раза в клетках, трансфицированных промотором CYP1A1, и примерно в 1,8 раза в клетках, трансфицированных промотором CYP1B1 (фиг. 6), демонстрируя, что сигнальный путь AhR был интактным и функциональным.

    Влияние OH-флутамида и TCDD на экспрессию эндогенных генов, регулируемых андрогенами, в UGS

    Эффекты OH-флутамида и TCDD на экспрессию эндогенных андроген-зависимых генов в UGS анализировали путем количественного определения мРНК для AR и 5α-редуктазы типа II. GD 14 UGS культивировали in vitro в течение трех дней с наполнителем, 10 -8 M DHT, DHT + 10 -5 M OH-флутамидом или DHT + 10 -9 M TCDD. Затем количество мРНК определяли с помощью ОТ-ПЦР в реальном времени.DHT значительно снижает экспрессию мРНК AR (фиг. 7A). OH-флутамид предотвращал этот эффект DHT, в то время как TCDD не ингибировал индуцированное DHT подавление регуляции количества мРНК AR (фиг. 7A). Эффекты DHT на экспрессию мРНК для 5α-редуктазы типа II были противоположными, но картина эффектов была той же. DHT увеличивал относительное содержание мРНК 5α-редуктазы типа II примерно в 13 раз, OH-флутамид сильно ингибировал эту индукцию, а TCDD не влиял на способность DHT индуцировать экспрессию мРНК 5α-редуктазы типа II (рис.7Б).

    ОБСУЖДЕНИЕ

    Ингибирование образования зачатков эпителия предстательной железы, по-видимому, не связано с недостаточной андрогенной стимуляцией

    Критическое окно для воздействия TCDD на рост и развитие предстательной железы у мышей – это в первую очередь период беременности (Lin et al. , 2002b) и процесс образования зачатка эпителия предстательной железы, который ингибируется in utero. Lin et al., , 2003) является пренатальным событием.На содержание андрогенов в яичках новорожденных и концентрации андрогенов в сыворотке после отъема, как правило, не влияли in utero и лактационный TCDD у мышей C57BL / 6J (Ko et al. , 2002; Lin et al. , 2002a), но возможные эффекты на пренатальные уровни андрогенов не исследовались. Отсутствие эффекта воздействия in utero TCDD на содержание тестостерона в яичках на GD 16 и 18 убедительно свидетельствует о том, что ингибирование образования эпителиальных зачатков предстательной железы не является результатом снижения биосинтеза тестостерона.

    TCDD может также ингибировать андрогенную стимуляцию UGS и, таким образом, ингибировать образование почки простаты, ингибируя превращение тестостерона в DHT в UGS. Однако воздействие in utero TCDD не ингибировало образование DHT из тестостерона в UGS, культивируемых in vitro . И уровни мРНК для фермента, который катализирует эту реакцию, 5α-редуктазы типа II, также не снизились. Эти результаты в сочетании с результатами определения тестостерона в яичках позволяют предположить, что TCDD не снижает концентрации DHT в UGS.

    Ранее мы показали, что экзогенный DHT не может предотвратить ингибирование TCDD образования зачатков эпителия предстательной железы in vivo (Lin et al. , 2003). Этот эксперимент продемонстрировал, что подавление почкования происходит не только из-за недостаточного количества DHT, но он не исключил возможность того, что неадекватные концентрации DHT могут быть одним из нескольких факторов, вызывающих подавление. Результаты, представленные в этом отчете, предполагают, что воздействие in utero TCDD на формирование эпителиального зачатка предстательной железы не связано с недостаточным DHT в UGS.

    ОН-флутамид в качестве положительного контроля для проверки гипотезы о том, что TCDD ингибирует образование почки предстательной железы, подавляя передачу сигналов андрогенов

    ОН-флутамид был включен в эти эксперименты, потому что он является конкурентным антагонистом рецепторов андрогенов (Kemppainen et al. , 1992), который также снижает концентрации рецепторов андрогенов (List et al. , 2000), и потому что его родительская молекула флутамид может полностью ингибировать образование эпителиальных зачатков предстательной железы у крыс (Hib and Ponzio, 1995).Для того чтобы ОН-флутамид был действительным положительным контролем в наших экспериментах, он должен также ингибировать образование эпителиальных зачатков предстательной железы мышиной UGS in vitro, , как это делает TCDD (Lin et al. , в печати). Когда контрольные UGS инкубировали in vitro с DHT и либо OH-флутамидом, либо TCDD, ингибирующий эффект OH-флутамида на отростки был по крайней мере таким же сильным, как эффект TCDD, если не сильнее. Таким образом, OH-флутамид использовали в качестве положительного контроля для вмешательства в передачу сигналов андрогенов во всех последующих экспериментах, в которых изучали андроген-зависимые эффекты TCDD.

    Различия между эффектами ОН-флутамида и TCDD на UGS и на клетки, полученные из UGS

    Один из методов, использованных для проверки гипотезы о том, что TCDD ингибирует образование зачатков эпителия предстательной железы, препятствуя передаче сигналов андрогенов, заключался в том, чтобы определить, оказывают ли TCDD и OH-флутамид сравнимые эффекты на мезенхимные клетки UGS, трансфицированные андроген-чувствительной репортерной плазмидой MMTV-люциферазы. AR-антагонистические эффекты OH-флутамида были продемонстрированы в нескольких клеточных линиях, трансфицированных плазмидами-репортерами MMTV (Hartig et al., 2002; List et al. , 2000; Warriar et al. , 1993, 1994), но было неясно, будет ли AR оставаться функциональным в изолированных первичных мезенхимальных клетках UGS, потому что Gupta (1999) должен был трансфицировать эти клетки с помощью AR, чтобы получить андрогенный ответ. В нашей лаборатории активность люциферазы индуцировалась ДГТ, а ОН-флутамид подавлял эту индукцию без введения экзогенного АР. Насколько нам известно, это первое сообщение о существовании функционального эндогенного сигнального пути AR в первичных культурах мезенхимальных клеток UGS.

    В отличие от ОН-флутамида, TCDD не ингибировал передачу сигналов AR в анализе репортерного гена MMTV-люциферазы. Это предполагает, что TCDD не действует на мезенхимные клетки UGS, подавляя передачу сигналов андрогенов, и, следовательно, что TCDD ингибирует образование зачатков эпителия предстательной железы с помощью механизмов, иных, чем вмешательство в передачу сигналов андрогенов. Этот результат согласуется с отсутствием корреляции между активацией сигнального пути AHR и антиандрогенными эффектами, когда клетки яичника китайского хомячка временно котрансфицировали плазмидами AR и MMTV-люциферазы и обрабатывали агонистами AHR (Vinggaard et al., 2000). Напротив, 10 −7 M TCDD был слегка антиандрогенным в клетках карциномы предстательной железы PC-3, котрансфицированных AR и MMTV-люциферазными плазмидами (Schrader and Cooke, 2000), и 10 −8 , но не 10 −9 M TCDD ингибировал андроген-регулируемую транскрипционную активность в клетках рака простаты LNCaP, трансфицированных плазмидой MMTV-люциферазы (Jana et al. , 1999). Однако все наши эксперименты проводились при существенно более низкой концентрации TCDD (10 -9 M), и в пилотных экспериментах даже 10 -10 M TCDD ингибировал образование зачатка эпителия предстательной железы.

    Отсутствие влияния TCDD на андроген-зависимую экспрессию генов в первичных культурах мезенхимальных клеток UGS не было связано с присущей им неспособностью реагировать на TCDD, поскольку такая же концентрация TCDD значительно индуцировала экспрессию генов, когда эти клетки были трансфицированные репортерными конструкциями CYP1A1 и CYP1B1.

    Другой метод, который мы использовали для проверки гипотезы о том, что TCDD ингибирует образование зачатков эпителия предстательной железы, вмешиваясь в передачу сигналов андрогенов, заключался в том, чтобы определить, имеют ли TCDD и OH-флутамид сравнимые или разные эффекты на экспрессию эндогенных андроген-чувствительных генов.Известно, что DHT снижает количество мРНК AR (Prins and Woodham, 1995) и увеличивает количество мРНК 5α-редуктазы типа II (Berman et al. , 1995). Было показано, что ОН-флутамид противодействует андроген-индуцированному снижению количества мРНК AR в клеточной линии рака простаты человека (Ravenna et al. , 1995), в то время как in utero Воздействие флутамида снижает количество мРНК 5α-редуктазы II типа. в головном мозге новорожденных самцов крыс (Poletti et al. , 1998). А in utero и воздействие TCDD в период лактации снижало количество мРНК AR и увеличивало количество мРНК 5α-редуктазы типа II в вентральной части простаты у 49-дневных крыс (Ohsako et al., 2001). В настоящем исследовании OH-флутамид ингибировал способность DHT снижать количество мРНК AR, а OH-флутамид ингибировал способность DHT увеличивать количество мРНК 5α-редуктазы типа II в культурах органов UGS мышей, как и ожидалось. Напротив, TCDD не оказывал влияния на регулируемую DHT транскрипцию мРНК AR или 5α-редуктазы типа II в культивируемых UGS, даже несмотря на то, что он серьезно ингибировал отклик почкования in vitro на DHT в тех же условиях. Эти результаты предполагают, что ингибирующий эффект TCDD на образование зачатков предстательной железы в UGS не связан с общим ингибированием AR-опосредованной транскрипции генов в UGS.

    Возможные механизмы, с помощью которых TCDD ингибирует образование зачатков эпителия предстательной железы

    Наши наблюдения, что воздействие in utero TCDD не оказывает видимого влияния на содержание тестостерона в яичках пренатально или на превращение тестостерона в DHT с помощью UGS, и что TCDD не ингибирует стимулируемую DHT активность люциферазы в мезенхимальных клетках UGS и не влияет на транскрипцию. двух DHT-регулируемых эндогенных генов в UGS, убедительно свидетельствуют о том, что TCDD не ингибирует образование зачатков эпителия предстательной железы путем ингибирования начальных событий в передаче сигналов андрогенов.Используемая нами репортерная конструкция MMTV-люциферазы содержит согласованный элемент андрогенного ответа (Ham et al. , 1988; Roche et al. , 1992) и часто используется для исследования андрогенности или антиандрогенности (Schrader and Cooke, 2000; Тамура и др. , 2003; Теруанн и др. , 2002; Винггаард и др. , 1999). Хотя отсутствие влияния TCDD на стимулируемую DHT активность MMTV-люциферазы или на уровни мРНК AR и 5α-редуктазы II типа не полностью исключает возможность того, что TCDD может ингибировать некоторые аспекты начальных событий в передаче сигналов андрогенов, они настоятельно предполагают что TCDD ингибирует образование эпителиальных зачатков предстательной железы, воздействуя на события передачи сигналов AR ниже по течению и / или ингибируя андрогеннезависимые пути передачи сигналов.

    Одним из примеров механизма, с помощью которого TCDD может ингибировать нисходящие эффекты передачи сигналов AR, является влияние на путь передачи сигналов Sonic hedgehog (Shh). Shh представляет собой андроген-зависимый ген, экспрессия которого необходима для развития простаты (Podlasek et al. , 1999a). Необходимы дальнейшие исследования, чтобы определить, ингибирует ли TCDD отпочкование, изменяя активность сигнального пути Shh или других андроген-зависимых сигнальных путей в UGS.

    Факторы роста, не регулируемые андрогенами, такие как эпидермальный фактор роста, трансформирующий фактор роста-α, костный морфогенетический белок 4 и фактор роста фибробластов 10, играют роль в формировании эпителиальных зачатков предстательной железы (Lamm et al., 2001; Мизуно и Сайто, 1996; Сайто и Мизуно, 1995; Томсон и Кунья, 1999). Кроме того, гены гомеобокса Hoxa-10 , Hoxa-13 и Hoxd-13 не являются андроген-зависимыми, но действуют как регуляторы почкования (Podlasek et al. , 1997, 1999b, c). Соответственно, TCDD может влиять на те или иные андроген-независимые механизмы, участвующие в формировании зачатков простаты. В настоящее время для изучения этих возможностей используется анализ экспрессии генов.

    РИС.1.

    Влияние воздействия in utero TCDD на содержание тестостерона в семенниках у плодов мужского пола на GD 16 и 18. Самкам перорально вводили носитель или TCDD (5 мкг / кг) на GD 13. Каждая полоса представляет собой среднее значение ± SE из n = 5.

    РИС. 1.

    Влияние воздействия in utero TCDD на содержание тестостерона в семенниках у плодов мужского пола на GD 16 и 18. Самкам перорально вводили носитель или TCDD (5 мкг / кг) на GD 13. Каждая полоса представляет собой среднее значение ± SE из = 5.

    РИС. 2.

    Влияние воздействия in utero TCDD на метаболизм андрогенов в UGS, полученных от плодов мужского пола на GD 16. Органные культуры UGS плодов, подвергнутых in utero воздействию носителя или TCDD (5 мкг / кг плотины на GD 13 ) подвергались воздействию 10 -8 M [ 3 H] -тестостерона в течение 24 часов (A) или 48 часов (B). Каждая полоса представляет собой процент радиоактивности, связанной с тестостероном и каждым из его метаболитов (среднее значение ± стандартная ошибка) из пяти повторных культур органов UGS.

    РИС. 2.

    Влияние воздействия in utero TCDD на метаболизм андрогенов в UGS, полученных от плодов мужского пола на GD 16. Органные культуры UGS плодов, подвергнутых in utero воздействию носителя или TCDD (5 мкг / кг плотины на GD 13 ) подвергались воздействию 10 -8 M [ 3 H] -тестостерона в течение 24 часов (A) или 48 часов (B). Каждая полоса представляет собой процент радиоактивности, связанной с тестостероном и каждым из его метаболитов (среднее значение ± стандартная ошибка) из пяти повторных культур органов UGS.

    РИС. 3.

    Эффект ОН-флутамида и TCDD на DHT-стимулированное образование эпителиальных зачатков предстательной железы в культуре UGS-органов мышей. GD 14 UGS культивировали в течение пяти дней с носителем, 10 -8 M DHT, 10 -8 M DHT + 10 -5 M OH-флутамидом или 10 -8 M DHT + 10 -9 M TCDD. Мезенхима была ферментативно отделена от эпителия трипсином и удалена с помощью щипцов. Показаны репрезентативные изображения изолированного эпителия UGS, полученные с помощью сканирующей электронной микроскопии.Образцы ориентированы так, что вентральная область справа, а дорсальная область слева, и все при одинаковом увеличении. БН: шейка мочевого пузыря; U: уретра. Кончики стрелок указывают на зачатки эпителия предстательной железы.

    РИС. 3.

    Эффект ОН-флутамида и TCDD на DHT-стимулированное образование эпителиальных зачатков предстательной железы в культуре UGS-органов мышей. GD 14 UGS культивировали в течение пяти дней с носителем, 10 -8 M DHT, 10 -8 M DHT + 10 -5 M OH-флутамидом или 10 -8 M DHT + 10 -9 M TCDD.Мезенхима была ферментативно отделена от эпителия трипсином и удалена с помощью щипцов. Показаны репрезентативные изображения изолированного эпителия UGS, полученные с помощью сканирующей электронной микроскопии. Образцы ориентированы так, что вентральная область справа, а дорсальная область слева, и все при одинаковом увеличении. БН: шейка мочевого пузыря; U: уретра. Кончики стрелок указывают на зачатки эпителия предстательной железы.

    РИС. 4.

    Влияние ОН-флутамида и TCDD на количество зачатков предстательной железы в культуре органов UGS, стимулированной DHT.GD 14 UGS культивировали в течение пяти дней с носителем, 10 -8 M DHT, 10 -8 M DHT + 10 -5 M OH-флутамидом или 10 -8 M DHT + 10 -9 M TCDD. Мезенхиму удаляли и эпителиальные зачатки предстательной железы подсчитывали под световым микроскопом. Каждая полоса представляет собой среднее значение ± стандартная ошибка n = 5. * Значительно отличается от носителя и † значительно отличается от группы DHT ( p <0,05).

    РИС. 4.

    Влияние ОН-флутамида и TCDD на количество зачатков предстательной железы в культуре органов UGS, стимулированной DHT.GD 14 UGS культивировали в течение пяти дней с носителем, 10 -8 M DHT, 10 -8 M DHT + 10 -5 M OH-флутамидом или 10 -8 M DHT + 10 -9 M TCDD. Мезенхиму удаляли и эпителиальные зачатки предстательной железы подсчитывали под световым микроскопом. Каждая полоса представляет собой среднее значение ± стандартная ошибка n = 5. * Значительно отличается от носителя и † значительно отличается от группы DHT ( p <0,05).

    РИС.5.

    Влияние ОН-флутамида и TCDD на андроген-зависимую активность люциферазы в первичных мезенхимальных клетках UGS. Первичные мезенхимные клетки получали из UGS, которые культивировали в течение трех дней, начиная с GD 14, с 10 -8 M DHT и либо 0,1% DMSO (A), либо 10 -9 M TCDD (B). Затем первичные клетки трансфицировали плазмидой MMTV-люциферазы (репортерный ген андроген-зависимой люциферазы) и инкубировали в течение 12 ч с носителем, 10 -8 M DHT, 10 -8 M DHT + 10 -5 M OH -флутамид, или 10 −8 M DHT + 10 −9 M TCDD.Каждая полоса представляет собой среднее значение ± стандартная ошибка n = 5. * Значительно отличается от носителя ( p <0,05).

    РИС. 5.

    Влияние ОН-флутамида и TCDD на андроген-зависимую активность люциферазы в первичных мезенхимальных клетках UGS. Первичные мезенхимные клетки получали из UGS, которые культивировали в течение трех дней, начиная с GD 14, с 10 -8 M DHT и либо 0,1% DMSO (A), либо 10 -9 M TCDD (B). Затем первичные клетки трансфицировали плазмидой MMTV-люциферазы (репортерный ген андроген-зависимой люциферазы) и инкубировали в течение 12 ч с носителем, 10 -8 M DHT, 10 -8 M DHT + 10 -5 M OH -флутамид, или 10 −8 M DHT + 10 −9 M TCDD.Каждая полоса представляет собой среднее значение ± стандартная ошибка n = 5. * Значительно отличается от носителя ( p <0,05).

    РИС. 6.

    Индукция активности CYP1A1- и CYP1B1-люцифераз с помощью TCDD в первичных мезенхимальных клетках UGS, полученных из UGS, полученных на GD 14 и культивированных в течение трех дней с 10 -8 M DHT. Первичные мезенхимные клетки UGS трансфицировали либо (A) pGudluc1.1, либо (B) pCyp1B1-luc (1075 / + 371) и инкубировали в течение 12 часов с 10 -8 M DHT и либо носителем, либо 10 -9 M TCDD.Каждая полоса представляет собой среднее значение ± стандартная ошибка n = 5. * Значительно отличается от носителя ( p <0,05).

    РИС. 6.

    Индукция активности CYP1A1- и CYP1B1-люцифераз с помощью TCDD в первичных мезенхимальных клетках UGS, полученных из UGS, полученных на GD 14 и культивированных в течение трех дней с 10 -8 M DHT. Первичные мезенхимные клетки UGS трансфицировали либо (A) pGudluc1.1, либо (B) pCyp1B1-luc (1075 / + 371) и инкубировали в течение 12 часов с 10 -8 M DHT и либо носителем, либо 10 -9 M TCDD.Каждая полоса представляет собой среднее значение ± стандартная ошибка n = 5. * Значительно отличается от носителя ( p <0,05).

    РИС. 7.

    Влияние TCDD на андроген-регулируемую экспрессию генов в UGS. Экспрессия мРНК (A) AR и (B) 5α-редуктазы типа II (относительно мРНК циклофилина) в UGS GD 14, культивированных в течение трех дней с носителем, 10 -8 M DHT, 10 -8 M DHT + 10 −5 M OH-флутамид, или 10 −8 M DHT + 10 −9 M TCDD.Каждая полоса представляет собой среднее значение ± стандартная ошибка n = 5. * Значительно отличается от носителя и † значительно отличается от группы DHT ( p <0,05).

    РИС. 7.

    Влияние TCDD на андроген-регулируемую экспрессию генов в UGS. Экспрессия мРНК (A) AR и (B) 5α-редуктазы типа II (относительно мРНК циклофилина) в UGS GD 14, культивированных в течение трех дней с носителем, 10 -8 M DHT, 10 -8 M DHT + 10 −5 M OH-флутамид, или 10 −8 M DHT + 10 −9 M TCDD.Каждая полоса представляет собой среднее значение ± стандартная ошибка n = 5. * Значительно отличается от носителя и † значительно отличается от группы DHT ( p <0,05).

    ТАБЛИЦА 1

    Последовательности праймеров для ПЦР в реальном времени, размеры продуктов и температуры отжига

    Ген (регистрационный номер GenBank)
    .
    Праймеры пары
    .
    Размер (п.
    .
    Темп.(° C)
    .
    циклофилина (M60456) CAGGAGAGAAAGGATTTGGC 210 60
    TGAGGCATTGGTGTCTTTGGC
    андрогенных рецепторов (NM013476) AACCAGATTCCTTTGCTGCC 195 62
    TGACATTAGTGAAGGACCGCC
    тип 5α-редуктазы II (NM053188) ACACAGACATGCGGTTTAGCG 225 60
    AAGCAAAGGCTGGAACAGACC
    +

    +

    +

    +

    Джин (Регистрационный номер GenBank)
    .
    Праймеры пары
    .
    Размер (п.
    .
    Темп. (° C)
    .
    циклофилина (M60456) CAGGAGAGAAAGGATTTGGC 210 60
    TGAGGCATTGGTGTCTTTGGC
    андрогенных рецепторов (NM013476) AACCAGATTCCTTTGCTGCC 195 62
    TGACATTAGTGAAGGACCGCC
    тип 5α-редуктазы II (NM053188) ACACAGACATGCGGTTTAGCG 225 60
    AAGCAAAGGCTGGAACAGACC

    ТАБЛИЦА 1

    Последовательности праймеров для ПЦР в реальном времени, размеры продуктов и температуры отжига

    Ген (номер доступа GenBank.)
    .
    Праймеры пары
    .
    Размер (п.
    .
    Темп. (° C)
    .
    циклофилина (M60456) CAGGAGAGAAAGGATTTGGC 210 60
    TGAGGCATTGGTGTCTTTGGC
    андрогенных рецепторов (NM013476) AACCAGATTCCTTTGCTGCC 195 62
    TGACATTAGTGAAGGACCGCC
    тип 5α-редуктазы II (NM053188) ACACAGACATGCGGTTTAGCG 225 60
    AAGCAAAGGCTGGAACAGACC
    +

    +

    +

    +

    +

    Джин (Регистрационный номер GenBank)
    .
    Праймеры пары
    .
    Размер (п.
    .
    Темп. (° C)
    .
    циклофилина (M60456) CAGGAGAGAAAGGATTTGGC 210 60
    TGAGGCATTGGTGTCTTTGGC
    андрогенных рецепторов (NM013476) AACCAGATTCCTTTGCTGCC 195 62
    TGACATTAGTGAAGGACCGCC
    тип 5α-редуктазы II (NM053188) ACACAGACATGCGGTTTAGCG 225 60
    AAGCAAAGGCTGGAACAGACC

    была сделана Эта публикация возможно благодаря гранту ES01332 Национального института здравоохранения Р.E.P. и грантом P30 ES09090 Национального института гигиены окружающей среды Центру развития и молекулярной токсикологии EHS Университета Висконсин-Мэдисон. Мы благодарим доктора К. Тендлера (Procter and Gamble Co.) за любезно предоставленный ОН-флутамид, Drs. А.О. Бринкманн (Медицинский центр Университета Эразма, Роттердам, Нидерланды), М.С. Денисон (Калифорнийский университет, Дэвис, Калифорния), CR Jefcoate (Университет Висконсина, Мэдисон, Висконсин) за плазмиды и д-р Р.М. Альбрехт за предоставление сканирующего электрона. установка для микроскопии.Мы также благодарим г-на Дж. М. Ли и г-жу Дж. Л. Смит за отличную техническую помощь.

    ССЫЛКИ

    Альгрен-Бекендорф, Дж. А., Райзинг, А. М., Шандер, М. А., Хердлер, Дж. У. и Джонсон, Дж. А.

    1999

    . Координированная регуляция НАД (Ф) Н: хинон оксидоредуктазы и глутатион-S-трансферазы в первичных культурах нейронов и глии крыс: роль антиоксидантного / электрофильного чувствительного элемента.

    Glia

    25

    ,

    131

    –142.

    Бард Д. Р., Ласницки И. и Мизуно Т.

    1979

    . Метаболизм тестостерона эпителием и мезенхимой мочеполовой пазухи крыс.

    J. Endocrinol.

    83

    ,

    211

    –218.

    Берман Д. М., Тиан Х. и Рассел Д. В.

    1995

    . Экспрессия и регуляция стероидной 5α-редуктазы в урогенитальном тракте плода крысы.

    Мол. Эндокринол.

    9

    ,

    1561

    –1570.

    Браун, Т. Р., Любан, Д. Б., Уилсон, Э. М., Френч, Ф. С., Миджон, К. Дж., И Корден, Дж. Л.

    1990

    . Функциональная характеристика встречающихся в природе мутантных рецепторов андрогенов от субъектов с полной нечувствительностью к андрогенам.

    Мол. Эндокринол.

    4

    ,

    1759

    –1772.

    Карлсон Д. Б. и Пердью Г. Х.

    2002

    . Динамическая роль рецептора Ah в передаче сигналов клетками? Выводы из разнообразной группы белков, взаимодействующих с рецептором Ah.

    J. Biochem. Мол. Toxicol.

    16

    ,

    317

    –325.

    Кук П. С., Янг П. и Кунья Г. Р.

    1991

    . Экспрессия рецепторов андрогенов в развивающихся мужских репродуктивных органах.

    Эндокринология

    128

    ,

    2867

    –2873.

    Cunha, G. R., and Lung, B.

    1978

    . Возможное влияние временных факторов на андрогенную чувствительность рекомбинантов урогенитальной ткани от мышей дикого типа и мышей, нечувствительных к андрогенам (Tfm).

    J. Exp. Zool.

    205

    ,

    181

    –193.

    Гаррисон, П. М., Таллис, К., Аартс, Дж. М. М. Дж. Г., Брауэр, А., Гизи, Дж. П., и Денисон, М. С.

    1996

    . Видоспецифические рекомбинантные клеточные линии в качестве биологических аналитических систем для обнаружения 2,3,7,8-тетрахлордибензо- p -диоксиноподобных химических веществ.

    Fundam. Прил. Toxicol.

    30

    ,

    194

    –203.

    Гасевич, Т.А., и Парк, С.-К.

    2003

    .Рецептор Ah: участие в токсических реакциях. В

    Диоксины и здоровье

    , 2-е изд. (Под ред. А. Шектера и Т. А. Гасевича), стр. 491–532. Джон Уайли и сыновья, Хобокен, штат Нью-Джерси.

    Гриффин, Дж. Э., Макфол, М. Дж., Рассел, Д. У., и Уилсон, Дж. Д.

    1995

    . Синдромы резистентности к андрогенам: дефицит стероидной 5α-редуктазы 2, феминизация яичек и родственные нарушения. В

    Метаболические и молекулярные основы наследственных болезней

    , 7-е изд. (К.Р. Скривнер, А.Л. Боде, В.С. Слай, Д. Валле, ред.), Стр. 2967–2988. Макгроу-Хилл, Сент-Луис.

    Гупта, К.

    1999

    . Модуляция опосредованной рецептором андрогена (AR) транскрипционной активности с помощью EGF в развивающихся первичных клетках репродуктивного тракта мыши.

    Мол. Клетка. Эндокринол.

    152

    ,

    169

    –178.

    Хэм, Дж., Томсон, А., Нидхэм, М., Уэбб, П., и Паркер, М.

    1988

    . Характеристика элементов ответа на андрогены, глюкокортикоиды и прогестины в вирусе опухоли молочной железы мышей.

    Nucleic Acids Res.

    16

    ,

    5263

    –5276.

    Хартиг, П. К., Бобсейн, К. Л., Бритт, Б. Х., Кардон, М. К., Ламбрайт, К. Р., Уилсон, В. С., и Грей, Л. Е., младший

    2002

    . Разработка двух анализов рецепторов андрогенов с использованием аденовирусной трансдукции репортера MMTV-luc и / или hAR для эндокринного скрининга.

    Toxicol. Sci.

    66

    ,

    82

    –90.

    Хиб Дж. И Понцио Р.

    1995

    .Аномальное развитие мужских половых органов у крыс с использованием чистого антиандрогена и ингибитора 5α-редуктазы во время беременности.

    Acta Physiol. Pharmacol. Ther. Латиноам.

    45

    ,

    27

    –33.

    Игучи Т., Уэсуги Ю., Такасуги Н. и Петроу В.

    1991

    . Количественный анализ развития половых органов из мочеполовой пазухи эмбрионального самца мыши, пренатально обработанного ингибитором 5α-редуктазы.

    J. Endocrinol.

    128

    ,

    395

    –401.

    Яна Н. Р., Саркар С., Исидзука М., Йонемото Дж., Тохьяма К. и Соне Х.

    1999

    . Перекрестная связь между 2,3,7,8-тетрахлордибензо- p -диоксином и путями передачи сигнала тестостерона в клетках рака простаты LNCaP.

    Biochem. Биофиз. Res. Commun.

    256

    ,

    462

    –468.

    Кемппайнен, Дж. А., Лейн, М. В., Сар, М., и Уилсон, Э. М.

    1992

    .Фосфорилирование рецепторов андрогенов, оборот, ядерный транспорт и активация транскрипции. Специфичность для стероидов и антигормонов.

    J. Biol. Chem.

    267

    ,

    968

    –974.

    Ко К., Мур Р. У. и Петерсон Р. Э. (в печати). Рецепторы арилуглеводородов в мезенхиме урогенитального синуса опосредуют ингибирование образования зачатков эпителия предстательной железы с помощью 2,3,7,8-тетрахлордибензо- p -диоксина.

    Toxicol. Прил. Pharmacol.

    Ко, К., Теобальд, Х. М., и Петерсон, Р. Э.

    2002

    . In utero и лактационное воздействие 2,3,7,8-тетрахлордибензо- p -диоксина в предстательной железе мышей C57BL / 6J: Лопастные эффекты на морфогенез ветвления.

    Toxicol. Sci.

    70

    ,

    227

    –237.

    Кумар, М. Б., и Пердью, Г. Х.

    1999

    . Коактиватор ядерного рецептора SRC-1 взаимодействует с Q-богатым субдоменом AhR и модулирует его потенциал трансактивации.

    Gene Expr.

    8

    ,

    273

    –286.

    Кумар, М. Б., Тарпи, Р. У., и Пердью, Г. Х.

    1999

    . Дифференциальное привлечение коактиватора RIP140 Ah и рецепторами эстрогена. Отсутствие роли мотивов L XX LL.

    J. Biol. Chem.

    274

    ,

    22155

    –22164.

    Ламм, М. Л., Подласек, К. А., Барнетт, Д. Х., Ли, Дж., Клеменс, Дж. К., Хебнер, К. М., и Бушман, В.

    2001

    .Костный морфогенетический белок 4 мезенхимального фактора ограничивает морфогенез зачатков и ветвлений протоков в развивающейся простате.

    Dev. Биол.

    232

    ,

    301

    –314.

    Ласницки И. и Мизуно Т.

    1977

    . Индукция предстательной железы крысы андрогенами в органной культуре.

    J. Endocrinol.

    74

    ,

    47

    –55.

    Ласницки И. и Мизуно Т.

    1980

    . Индукция простаты: взаимодействие эпителия и мезенхимы у нормальных мышей дикого типа и мышей, нечувствительных к андрогенам, с феминизацией яичек.

    J. Endocrinol.

    85

    ,

    423

    –428.

    Лин Т.-М., Ко К., Мур Р. В., Симанайнен У., Оберли Т. Д. и Петерсон Р. Э.

    2002

    . Влияние нулевой мутации арилуглеводородного рецептора и in utero и воздействия лактационного 2,3,7,8-тетрахлордибензо- p -диоксина на развитие предстательной железы и семенных пузырьков у мышей C57BL / 6.

    Toxicol. Sci.

    68

    ,

    479

    –487.

    Линь Т.-М., Расмуссен, Н. Т., Мур, Р. В., Альбрехт, Р. М., и Петерсон, Р. Е.

    2003

    . Регионоспецифическое ингибирование образования зачатков эпителия предстательной железы в урогенитальном синусе мышей C57BL / 6 подвергало in utero воздействию 2,3,7,8-тетрахлордибензо- p -диоксина.

    Toxicol. Sci.

    76

    ,

    171

    –181.

    Лин Т.-М., Расмуссен Н. Т., Мур Р. У., Альбрехт Р. М. и Петерсон Р. Э. (в печати). 2,3,7,8-Тетрахлордибензо- p -диоксин ингибирует образование зачатков эпителия предстательной железы, воздействуя непосредственно на мочеполовую пазуху.

    J. Urol.

    Лин Т.-М., Симанайнен У., Мур Р. В. и Петерсон Р. Э.

    2002

    . Критические окна уязвимости для эффектов 2,3,7,8-тетрахлордибензо- p -диоксина на развитие простаты и семенных пузырьков у мышей C57BL / 6.

    Toxicol. Sci.

    69

    ,

    202

    –209.

    Лист, Х.-Дж., Смит, К. Л., Мартинес, Э., Харрис, В. К., Даниэльсен, М., и Ригель, А. Т.

    2000

    . Влияние антиандрогенов на ремоделирование хроматина и транскрипцию интегрированного промотора вируса опухоли молочной железы мыши.

    Exp. Cell Res.

    260

    ,

    160

    –165.

    Махендру, М. С., Рассел, Д. В.

    1999

    . Мужской и женский изоферменты стероидной 5α-редуктазы.

    Ред.

    4

    ,

    179

    –183.

    Миямото, Х., Рахман, М., Такатера, Х., Кан, Х.-Й., Йе, С., Чанг, Х.-К., Нишимура, К., Фудзимото, Н., и Чанг, С.

    2002

    . Доминантно-отрицательный мутант корегулятора рецептора андрогена ARA54 ингибирует опосредованный рецептором андрогена рост рака простаты.

    J. Biol. Chem.

    277

    ,

    4609

    –4617.

    Мизуно Т. и Сайто М.

    1996

    . Индукция зачатков предстательной железы в урогенитальном синусе у эмбрионов мышей с дефицитом андрогенных рецепторов Tfm .

    C. R. Seances Soc. Биол.

    190

    ,

    497

    –501.

    Моеленкамп Дж. Д. и Джонсон Дж. А.

    1999

    . Активация антиоксидантных / электрофильных элементов в клетках нейробластомы человека IMR-32.

    Arch. Biochem. Биофиз.

    363

    ,

    98

    –106.

    Осако, С., Миябара, Ю., Нисимура, Н., Куросава, С., Сакауэ, М., Ишимура, Р., Сато, М., Такеда, К., Аоки, Ю., Соне, Х. , Tohyama, C., and Yonemoto, J.

    2001

    . Воздействие на мать низкой дозы 2,3,7,8-тетрахлордибензо- p -диоксина (TCDD) подавляло развитие репродуктивных органов самцов крыс: дозозависимое увеличение уровней мРНК 5α-редуктазы 2 типа, напротив к снижению рецепторов андрогенов в пубертатной вентральной простате.

    Toxicol. Sci.

    60

    ,

    132

    –143.

    Подласек, К. А., Барнетт, Д. Х., Клеменс, Дж. К., Бак, П. М., и Бушман, В.

    1999

    . Для развития простаты требуется Sonic hedgehog, экспрессируемый эпителием урогенитального синуса.

    Dev. Биол.

    209

    ,

    28

    –39.

    Подласек, К. А., Клеменс, Дж. К., и Бушман, В.

    1999

    . Hoxa-13 Мутация гена приводит к аномальному развитию семенных пузырьков и простаты.

    J. Urol.

    161

    ,

    1655

    –1661.

    Подласек, К. А., Дубул, Д., и Бушман, В.

    1997

    . Морфогенез мужских дополнительных половых органов изменяется из-за потери функции Hoxd-13 .

    Dev. Дин.

    208

    ,

    454

    –465.

    Подласек, К. А., Сео, Р. М., Клеменс, Дж. К., Ма, Л., Маас, Р. Л., и Бушман, В.

    1999

    . Hoxa-10 Самцы мышей с дефицитом обнаруживают аномальное развитие дополнительных половых органов.

    Dev. Дин.

    214

    ,

    1

    –12.

    Полетти, А., Негри-Чези, П., Рабуффетти, М., Колчиаго, А., Челотти, Ф., и Мартини, Л.

    1998

    . Временная экспрессия изофермента 5α-редуктазы 2 типа в головном мозге крыс на поздних этапах внутриутробной и ранней постнатальной жизни.

    Эндокринология

    139

    ,

    2171

    –2178.

    Принс, Г. С., и Вудхэм, К.

    1995

    . Аутологичная регуляция рибонуклеиновой кислоты, мессенджера андрогенных рецепторов, в отдельных долях предстательной железы крысы.

    Biol. Репрод.

    53

    ,

    609

    –619.

    Куигли, К. А., Эванс, Б. А. Дж., Сименталь, Дж. А., Маршке, К. Б., Сар, М., Любан, Д. Б., Дэвис, П., Хьюз, И. А., Уилсон, Э. М., и Френч, Ф. С.

    1992

    . Полная нечувствительность к андрогенам из-за делеции экзона C гена рецептора андрогенов подчеркивает функциональную важность второго цинкового пальца рецептора андрогенов in vivo .

    Мол. Эндокринол.

    6

    ,

    1103

    –1112.

    Равенна, Л., Лубрано, К., Ди Сильверио, Ф., Вакка, А., Фелли, М. П., Мародер, М., Д’Эрамо, Г., Шиарра, Ф., Фрати, Л., Гулино, А., Петрангели Э.

    1995

    . Андрогенный и антиандрогенный контроль эпидермального фактора роста, рецептора эпидермального фактора роста и экспрессии андрогенного рецептора в линии клеток рака простаты человека LNCaP.

    Простата

    26

    ,

    290

    –298.

    Рош, П. Дж., Хоар, С. А., и Паркер, М. Г.

    1992

    .Консенсусный сайт связывания ДНК для рецептора андрогенов.

    Мол. Эндокринол.

    6

    ,

    2229

    –2235.

    Сайто М. и Мизуно Т.

    1995

    . Фактор эпидермального роста (EGF) может индуцировать зачатки предстательной железы в отсутствие андрогенов.

    C. R. Seances Soc. Биол.

    189

    ,

    637

    –641.

    Шредер Т. Дж. И Кук Г. М.

    2000

    . Исследование отдельных пищевых добавок и хлорорганических загрязнителей пищевых продуктов на андрогенную активность in vitro .

    Toxicol. Sci.

    53

    ,

    278

    –288.

    Тамура, Х., Йошикава, Х., Гайдо, К. В., Росс, С. М., Делисл, Р. К., Уэлш, У. Дж., И Ричард, А. М.

    2003

    . Взаимодействие фосфорорганических пестицидов и родственных соединений с рецептором андрогенов.

    Environ. Перспектива здоровья.

    111

    ,

    545

    –552.

    Теруанн Б., Пэрис Ф., Слуга Н., Жорже В. и Султан К.

    2002

    .Доказательства того, что хлормадинона ацетат проявляет антиандрогенную активность в андроген-зависимой клеточной линии.

    Мол. Клетка. Эндокринол.

    198

    ,

    143

    –147.

    Теобальд, Х. М., Роман, Б. Л., Лин, Т.-М., Отани, С., Чен, С.-В., и Петерсон, Р. Е.

    2000

    . 2,3,7,8-Тетрахлордибензо- p -диоксин ингибирует дифференцировку люминальных клеток и андрогенную чувствительность вентральной простаты, не ингибируя образование 5α-дигидротестостерона простаты или продукцию андрогенов в яичках у потомства крыс.

    Toxicol. Sci.

    58

    ,

    324

    –338.

    Тиле Б., Вайдеманн В., Шнабель Д., Ромало Г., Швейкерт Х.-У. и Шпиндлер К.-Д.

    1999

    . Полная нечувствительность к андрогенам, вызванная новой делецией со сдвигом рамки считывания двух пар оснований в экзоне 1 гена рецептора андрогенов человека.

    J. Clin. Эндокринол. Метаб.

    84

    ,

    1751

    –1753.

    Томсон, А., и Кунья, Г. Р.

    1999

    .Рост и развитие предстательной железы регулируются FGF10.

    Девелопмент

    126

    ,

    3693

    –3701.

    Тиммс, Б. Г., Моос, Т. Дж., И Дидио, Л. Дж. А.

    1994

    . Паттерны почкования и ветвления протоков в развивающейся простате.

    J. Urol.

    151

    ,

    1427

    –1432.

    Вингаард А.М., Хнида К. и Ларсен Дж. К.

    2000

    . Полициклические ароматические углеводороды окружающей среды влияют на активацию рецепторов андрогенов in vitro.

    Токсикология

    145

    ,

    173

    –183.

    Вингаард А.М., Йоргенсен Э.С.Б. и Ларсен Дж. К.

    1999

    . Быстрые и чувствительные анализы репортерных генов для выявления антиандрогенных и эстрогенных эффектов химических веществ в окружающей среде.

    Toxicol. Прил. Pharmacol.

    155

    ,

    150

    –160.

    Уорриар Н., Пейдж Н., Куцилиерис М. и Говиндан М. В.

    1993

    . Взаимодействие антиандроген-андрогенных рецепторных комплексов с ДНК и активация транскрипции.

    J. Steroid Biochem. Мол. Биол.

    46

    ,

    699

    –711.

    Уорриар Н., Пейдж Н., Куцилиерис М. и Говиндан М. В.

    1994

    . Антиандрогены подавляют активацию транскрипции генов, зависимых от рецепторов андрогенов человека, в клетках рака простаты человека LNCaP.

    Простата

    24

    ,

    176

    –186.

    Сюй Дж., Цю Ю., ДеМайо Ф. Дж., Цай С. Ю., Цай М.-Дж. и О’Мэлли Б. В.

    1998

    .Частичная гормональная резистентность у мышей с нарушением гена коактиватора-1 стероидных рецепторов (SRC-1).

    Наука

    279

    ,

    1922

    –1925.

    Чжан Л., Савас Ю., Александер Д. Л. и Джефкоат К. Р.

    1998

    . Характеристика мышиного гена Cyp1B1 . Идентификация энхансерной области, которая управляет конститутивной и индуцированной экспрессией, опосредованной арилуглеводородным рецептором.

    J. Biol. Chem.

    273

    ,

    5174

    –5183.

    Заметки автора

    * Программа эндокринологии и репродуктивной физиологии, † Фармацевтический факультет и ‡ Центр молекулярной и экологической токсикологии, Университет Висконсина, Мэдисон, Висконсин 53705

    Токсикологические науки vol. 79 нет. 2 © Общество токсикологии; все права защищены.

    Синусовая аритмия – обзор

    Предсердные аритмии

    Синусовая аритмия

    При синусовой аритмии блуждающие нервы и изменения дыхания могут изменять скорость разряда СА-узла.ЭКГ в норме, за исключением различной длины интервалов R – R (рис. 41.5). Вариации распространены, особенно при изменении частоты дыхания. Этот ритм очень распространен среди молодых людей и имеет тенденцию к снижению с возрастом. Лечение не требуется (Weiderhold, 1988; Mammen et al., 2004; Watchie, 2010; Hillegass, 2011).

    Синусовая брадикардия

    Синусовая брадикардия – это обычный синусовый ритм, но с частотой СА-узлов ниже 60 ударов в минуту (рис. 41.6). ЭКГ имеет нормальные зубцы P и интервалы P – R и соотношение проводимости между предсердиями и желудочками 1: 1, но частота предсердий менее 60 ударов в минуту.Он представляет собой подавление скорости разряда SA-узла, обычно в ответ на нормальную физиологию у спортсменов, во время сна и при стимуляции блуждающего нерва. Это может быть связано с наркотиками, особенно при употреблении наркотиков, бета-блокаторов и блокаторов кальциевых каналов. Патологии, которые могут вызывать ритм брадикардии, включают острый инфаркт миокарда, повышение внутричерепного давления, гиперчувствительность каротидного синуса и гипотиреоз. Если имеются признаки нарушения гемодинамики, необходимо лечение.Медикаментозное лечение может быть полезным в краткосрочной перспективе; однако пациентам с симптоматической рецидивирующей или стойкой брадикардией показана внутренняя кардиостимуляция (Weiderhold, 1988; Mammen et al., 2004; Watchie, 2010; Hillegass, 2011).

    Синусовая тахикардия

    Синусовая тахикардия – это ускорение частоты импульсного разряда СА-узла (рис. 41.7). ЭКГ имеет нормальные зубцы P и интервалы P – R и соотношение проводимости между предсердиями и желудочками 1: 1. Он отличается от нормального синусового ритма только тем, что частота составляет более 100 ударов в минуту.СА-тахикардия – это нормальная ожидаемая реакция на увеличение интенсивности упражнений. Это также может быть результатом нормальной физиологической реакции, наблюдаемой у младенцев, детей и взрослых с эмоциями, особенно тревогой. Это может быть связано с наркотиками, например, из-за употребления атропина, адреналина (адреналина), алкоголя, никотина и кофеина. Он также может отражать патологический процесс, такой как лихорадка, гипоксия, анемия, гиповолемия или тромбоэмболия легочной артерии. Во многих из этих состояний повышенная частота сердечных сокращений является результатом увеличения сердечного выброса в попытке удовлетворить повышенные потребности кровообращения.Показано лечение основного заболевания, особенно пациентам с ранее существовавшим сердечным заболеванием, поскольку повышенный сердечный выброс может еще больше усугубить любые проблемы с сердцем (Weiderhold, 1988; Mammen et al., 2004; Larry & Schaal, 2006; Watchie, 2010; Hillegass, 2011).

    Наджелудочковая тахикардия

    Наджелудочковые аритмии включают любой ритм, при котором деполяризующий импульс возникает выше уровня АВ-узла. Все эти ритмы имеют нормальный комплекс QRS после деполяризации.Наджелудочковая тахикардия (СВТ, также известная как пароксизмальная предсердная тахикардия) – это регулярный быстрый ритм, возникающий из любого участка выше бифуркации пучка Гиса (рис. 41.8). Ощущение сердцебиения и головокружения типичны для СВТ. У пациентов с ишемической болезнью сердца из-за учащенного сердцебиения могут возникать боли при стенокардии и одышка. СВТ также часто возникает у пациентов с плохой функцией левого желудочка, сердечной недостаточностью и отеком легких. Лечение включает прекращение приема любых лекарств, вызывающих заболевание, использование различных антиаритмических препаратов для контроля частоты сердечных сокращений и использование вагусных маневров (таких как массаж каротидного синуса, маневр Вальсальвы, задержка дыхания и кашель или рвота) для замедления частоты предсердий.Врач также может выполнить синхронизированную сердечную конверсию, особенно у нестабильного пациента с гипотонией, отеком легких или сильной болью в груди (Weiderhold, 1988; Mammen et al., 2004; Larry & Schaal, 2006; Hillegass, 2011).

    Преждевременные сокращения предсердий

    Преждевременные сокращения предсердий (PAC) происходят от эктопических кардиостимуляторов, расположенных в любом месте предсердия, кроме узла SA (рис. 41.9). ЭКГ показывает эктопические зубцы P, которые появляются раньше, чем следующее ожидаемое синусовое сокращение.Внематочный зубец P имеет другую форму и / или направление, чем нормальный зубец P. Эктопический зубец P не будет проводиться, если он достигает АВ-узла в течение периода абсолютной рефрактерности, но он будет проводиться с задержкой (более длительный интервал P – R) в течение периода относительной рефрактерности. PAC, которые проводятся через AV-узел, пучок His и ветви пучка, будут иметь типичные комплексы QRS. ПАК могут появиться в любом возрасте и часто наблюдаются при отсутствии сердечных заболеваний. Обычно считается, что стресс, утомляемость, алкоголь, табак и кофеин могут вызывать развитие ПАУ.Частые ПАУ наблюдаются при хронических заболеваниях легких, ишемической болезни сердца и токсичности наперстянки. Лечение включает устранение провоцирующих причин и устранение основных заболеваний. Если PAC вызывают симптомы или устойчивую тахикардию, следует применять лекарственную терапию с целью подавления PAC (Weiderhold, 1988; Mammen et al., 2004; Larry & Schaal, 2006; Malone, 2006; Hillegass, 2011).

    Фибрилляция предсердий

    Фибрилляция предсердий – одна из наиболее распространенных аритмий.Это происходит, когда несколько участков миокарда предсердий постоянно разряжаются и сокращаются (рис. 41.10). Предсердия буквально подергиваются или беспорядочно дрожат. Деполяризация и сокращение настолько дезорганизованы и нерегулярны, что предсердия скорее дрожат, чем сокращаются равномерно. Частота предсердий обычно выше 400 ударов в минуту, тогда как желудочковая частота ниже, потому что она ограничена временем рефрактерности АВ-узла. ЭКГ показывает фибриллярную активность предсердий вместо зубцов P и нерегулярный желудочковый ответ (Weiderhold, 1988; Mammen et al., 2004; Ларри и Шаал, 2006; Коллинз и Диас, 2009; Хиллегасс, 2011).

    В основном фибрилляция предсердий связана с двумя проблемами. Во-первых, предсердия не деполяризуются и, следовательно, нет сокращения предсердий. Сокращение предсердий может увеличить объем желудочков на 30%, поэтому без него сердечный выброс может снизиться до 30%. Сердечный выброс обычно не нарушается у людей с желудочковой реакцией менее 100 ударов в минуту; тем не менее, у человека с ЧСС в состоянии покоя более 100 ударов в минуту или у человека, выполняющего упражнения, признаки нарушения гемодинамики могут быть быстро обнаружены.Во-вторых, существует опасность свертывания крови в фибриллирующих предсердиях; может образоваться настенный тромб и впоследствии привести к эмболу. В целом у 30% всех пациентов с фибрилляцией предсердий развиваются эмболы (Watchie, 2010; Hillegass, 2011).

    Фибрилляция предсердий может возникать как пароксизмальный взрыв или как устойчивый ритм. Пожилой возраст, ревматический порок сердца, застойная сердечная недостаточность и гипертония – это состояния, при которых обычно возникает фибрилляция предсердий. Лечение зависит от общего состояния пациента.Лекарства можно применять у более стабильного пациента. Ответ лучше всего у тех, у кого фибрилляция предсердий лечится вскоре после начала. У лиц с гемодинамическими нарушениями другими вариантами лечения являются сердечная конверсия или кардиостимулятор (Weiderhold, 1988; Mammen et al., 2004; Watchie, 2010; Hillegass, 2011).

    Трепетание предсердий

    Точный механизм, участвующий в развитии трепетания предсердий, неизвестен, но проблема, по-видимому, касается только небольшой области предсердия (рис.41.11). Характеристики ЭКГ включают регулярную частоту предсердий 250–350 ударов в минуту и ​​пилообразные волны трепетания вместо зубцов P. Трепетание предсердий редко возникает при отсутствии ранее существовавшего сердечного заболевания. Заболеваемость наиболее высока у пациентов с ишемической болезнью сердца или острым инфарктом миокарда, но она также может быть осложнением застойных кардиомиопатий, миокардита, болезни митрального клапана, тромбоэмболии легочной артерии, тупой травмы грудной клетки и токсичности диоксина. Трепетание предсердий может возникать как преходящая аритмия между ритмом СА и фибрилляцией предсердий.Лечение состоит из сердечной конверсии или медикаментозной терапии в зависимости от клинического состояния пациента (Weiderhold, 1988; Mammen et al., 2004; Larry & Schaal, 2006; Malone, 2006; Collins and Dias, 2009; Hillegass, 2011).

    Соединительный ритм

    В нормальных условиях SA-узел разряжается с большей скоростью, чем AV-узел, поэтому кардиостимулятор в AV-соединении подавляется. Если отток SA-узла происходит медленно или не достигает AV-узла, то возникает аварийный импульс соединения (рис.41.12), обычно со скоростью 40–60 ударов в минуту. Как правило, эти ускользающие сокращения не проходят обратно в предсердия, поэтому на ЭКГ виден комплекс QRS без зубца Р. Однако, если импульс, генерируемый атриовентрикулярным узлом или соединительной тканью, отражается обратно в предсердия, его можно рассматривать как перевернутый зубец P до, во время или после сокращения желудочков. Всякий раз, когда есть достаточно длительная пауза перед тем, как импульс достигает АВ-узла, узловой кардиостимулятор может вызвать узловой ритм. Устойчивые ритмы выхода из узлов могут наблюдаться при застойной сердечной недостаточности, токсичности диоксинов или миокардите.(Мэлоун, 2006; Watchie, 2010; Hillegass, 2011).

    Соединительная тахикардия

    Усиленный соединительный импульс может перекрывать узел СА и вызывать либо ускоренный узловой ритм (частота 60–100 ударов в минуту), либо узловую тахикардию с частотой более 100 ударов в минуту. Зубцы P отсутствуют. Ускоренный узловой ритм или узловая тахикардия могут возникать при гипервентиляции, ишемической болезни сердца, токсичности диоксинов, чувствительности к кофеину или никотину, перенапряжению и эмоциональным факторам.Если усиленный ритм сохраняется и вызывает симптомы нарушения гемодинамики или ишемии, требуется терапия основной причины. Также может потребоваться острая терапия для увеличения частоты СА. При более высоких показателях трудно отличить СВТ от узловой тахикардии, потому что, если зубец P присутствует, он теряется в комплексе QRS и не визуализируется (Weiderhold, 1988; Mammen et al., 2004; Hillegass, 2011).

    Синусит F039 | Информация о СОП, СОП и вспомогательная информация – алфавитный список, от Q до Z

    Текущие инструменты RMA

    Изменения по сравнению с предыдущими инструментами

    Бюллетень СОП 204

    Кодирование ICD

    • Коды ICD -9 461, 473
    • Коды МКБ-10-AM: J01, J32

    Краткое описание

    Синусит (или риносинусит) – это воспаление носовой полости и придаточных пазух носа, которое может быть острым, рецидивирующим острым, подострым или острым. хронический.Острый синусит почти всегда возникает из-за вирусной инфекции. Хронический синусит имеет широкий спектр причинных факторов.

    Подтверждение диагноза

    Диагноз острого (носорогового) синусита основывается на анамнезе и имеющихся симптомах. Состояние обычно проходит в течение 10 дней, поэтому необходимо учитывать наличие заболевания. Рецидивирующий острый синусит может представлять собой отдельные не связанные между собой эпизоды, или может иметь место предрасположенность, например, иммуносупрессия.В последнем случае может быть целесообразно диагностировать основное заболевание и добавить к диагностической метке «с рецидивирующим синуситом».

    При хроническом (носороговом) синусите (продолжительностью 12 недель и более) диагноз ставится на основании анамнеза плюс наличие заболевания слизистой оболочки при обследовании (которое может включать риноскопию или эндоскопию) или радиологических изображениях (КТ или МРТ).

    Диагноз может сделать терапевт. Соответствующий медицинский специалист – хирург-ЛОР.

    Дополнительные диагнозы, на которые распространяется СОП

    • Абсцесс или эмпиема пазух
    • Острый риносинусит
    • Острый синусит
    • Хронический риносинусит
    • Хронический синусит

    баротравма СОП

  • Баросинусит * баротравма пазухи СОП
  • Аллергический ринит *
  • Вазомоторный ринит #
  • * применяется другой СОП

    # Состояние без СОП

    Клиническое начало

    Клиническое начало наступит, когда впервые проявятся текущие симптомы.Ранее исчезнувшие аналогичные симптомы с последующим периодом отсутствия симптомов, вероятно, представляют собой отдельное состояние. Хронический синусит (носорог) обычно неизлечим, но могут быть периоды хорошего контроля симптомов. Клиническое начало хронического синусита, скорее всего, наступит при появлении первых хронических симптомов, связанных с этим заболеванием.

    Клиническое ухудшение

    Ухудшение, как правило, не должно быть причиной острого (носорогового) синусита. При хроническом синусите следует обратиться к врачу за консультацией о том, произошло ли ухудшение, выходящее за рамки нормального течения болезни.

    Множественная миелома – NORD (Национальная организация по редким заболеваниям)

    Конкретные симптомы, возраст начала и скорость прогрессирования множественной миеломы варьируются от пациента к пациенту. У некоторых больных симптомы не проявляются (бессимптомно). Множественная миелома может прогрессировать и вызывать опасные для жизни осложнения. Важно отметить, что у пораженных людей не будут проявляться все симптомы, перечисленные ниже.

    Наиболее частым симптомом, связанным с множественной миеломой, является боль в костях, обычно в пояснице или ребрах.У большинства пациентов движение усиливает боль, которая может быть легкой, умеренной или сильной. Пораженные люди обычно более подвержены переломам, чем население в целом, и могут испытывать повторные переломы пораженных костей. Кости позвоночника могут быть вовлечены, потенциально разрушаясь и приводя к компрессии спинного мозга. Сдавливание спинного мозга вызывает боль, слабость и онемение в руках и ногах.

    Еще одним возможным признаком множественной миеломы является повышенный уровень кальция в крови, состояние, называемое гиперкальциемией.Это происходит потому, что повреждение костей часто приводит к выбросу кальция в кровоток. Аномально высокий уровень кальция может вызвать тошноту, отсутствие аппетита, усталость, боль в животе, мышечную боль и слабость, чрезмерную жажду и / или спутанность сознания.

    Избыточное производство плазматических клеток может также препятствовать производству и снижению эффективности других клеток организма, что приводит к появлению различных симптомов. У больных может наблюдаться низкий уровень циркулирующих эритроцитов (анемия), что приводит к слабости, утомляемости, головокружению, одышке и потере цвета (бледность).У больных также может наблюдаться низкий уровень клеток, способствующих свертыванию (тромбоцитов), состояние, известное как тромбоцитопения. Симптомы, связанные с тромбоцитопенией, включают эпизоды аномальных кровотечений, которые часто приводят к пурпурному изменению цвета кожи в результате кровотечения (кровоизлияния) из мелких кровеносных сосудов у поверхности кожи (пурпура). Редко у пораженных людей могут наблюдаться повторные носовые кровотечения (носовое кровотечение).

    У больных также может быть низкий уровень или пониженная эффективность лейкоцитов, что ослабляет иммунную систему и приводит к более высокой восприимчивости, чем у населения в целом, к развитию рецидивирующих бактериальных инфекций.Наиболее частая инфекция – пневмония. У некоторых пациентов рецидивирующие инфекции могут быть первым очевидным симптомом множественной миеломы.

    У людей с множественной миеломой также могут развиваться аномалии почек. У некоторых пациентов гиперкальциемия может вызвать поражение почек. Аномальные белки, обнаруженные в крови или моче (М-белки), которые вырабатываются миеломными клетками, могут вызывать повреждение почек (миелома почек). Почечные аномалии могут развиваться медленно или быстро и в конечном итоге могут прогрессировать, приводя к почечной (почечной) недостаточности.

    Редко у людей с множественной миеломой может быть аномально большая печень (гепатомегалия) или селезенка (спленомегалия). Редко множественная миелома может возникать в сочетании с другими заболеваниями. Три наиболее распространенных заболевания, которые могут возникать в связи с множественной миеломой, включают синдром гипервязкости, криоглобулинемию или амилоидоз.

    Синдром повышенной вязкости характеризуется аномально густой и липкой кровью из-за аномального накопления М-белков в крови.В результате кровоток замедляется. Синдром гипервязкости может вызывать головные боли, кровотечение из носа, усталость, частые синяки, желудочно-кишечные кровотечения и нарушения зрения, такие как заболевание сетчатки (ретинопатия).
    Криоглобулинемия – редкое заболевание, возникающее из-за накопления аномальных белков (криоглобулинов) в кровотоке.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *