С цыпленком противовирусное: Сироп Цитовир-3 препарат для профилактики и лечения ОРВИ и гриппа – «Даю для успокоения.»

Цитовир-3 сироп для детей инструкция по применению (2020 г.) от производителя МБНПК «Цитомед»

Состав

Действующие вещества:

Альфа-глутамил-триптофан натрий [Тимоген натрий] (в пересчете на альфа-глутамил-триптофан) 0,15 мг

Аскорбиновая кислота 12 мг

Бендазола гидрохлорид (дибазол) 1,25 мг

Вспомогательные вещества:

Сахароза 800,0 мг

Вода очищенная до 1 мл

Описание:

Сироп от бесцветного до жёлтого цвета.

Фармакотерапевтическая группа:

Иммуностимулирующее средство.

Код АТХ: L03AХ

Фармакологическое действие:

Фармакодинамика: препарат является средством этиотропной и иммуностимулирующей терапии, обладает опосредованным противовирусным действием в отношении возбудителей гриппа А и В, а также других вирусов, вызывающих острые респираторные заболевания. Снижает выраженность основных клинических симптомов гриппа и ОРВИ, а также сокращает продолжительность заболевания и способствует его неосложненному течению.

Увеличивает содержание секреторного иммуноглобулина А (slgA) в слизистой носоглотки – входных воротах инфекции, повышая местную иммунорезистентность организма к респираторным инфекциям вирусной и бактериальной природы.

При профилактическом действии препарат повышает потенциальную метаболическую активность клеток врожденного иммунитета (нейтрофильных гранулоцитов и моноцитов), что, в случае развития инфекции, увеличивает их способность к поглощению и разрушению бактериальных и вирусных агентов за счет усиления ферментативной (окислительной) активности, синтеза катионных белков и увеличения числа фагоцитирующих клеток. При этом исходное состояние метаболической активности клеток врожденного иммунитета, в отсутствии инфекционных агентов, не изменяется, находясь в пределах нормальных значений.

Бендазол индуцирует в организме выработку эндогенного интерферона, обладает иммуномодулирующим действием (нормализует иммунный ответ организма). Ферменты, выработка которых индуцируется интерфероном в клетках различных органов, ингибируют репликацию вирусов.

Альфа-глутамил-триптофан (тимоген) является синергистом иммуномодулирующего действия бендазола, нормализуя Т-клеточное звено иммунитета.

Аскорбиновая кислота активирует гуморальное звено иммунитета, нормализует проницаемость капилляров, уменьшая тем самым воспаление, и проявляет антиоксидантные свойства, нейтрализуя кислородные радикалы, сопровождающие воспалительный процесс, повышает устойчивость организма к инфекции.

Фармакокинетика:

при приеме внутрь препарат полностью всасывается из желудочно-кишечного тракта. Биодоступность бендазола – около 80 %, альфа-глутамил-триптофана – не более 15 %, аскорбиновой кислоты – до 70 %. Аскорбиновая кислота абсорбируется в ЖКТ (преимущественно в тощей кишке). Связь с белками плазмы – 25%. TCmax после приема внутрь – 4 ч. Легко проникает в лейкоциты, тромбоциты, а затем во все ткани, проникает через плаценту. Заболевания ЖКТ (язвенная болезнь желудка и 12-перстной кишки, нарушения моторики кишечника, глистная инвазия, лямблиоз), употребление овощных и фруктовых соков, щелочного питья уменьшают связывание аскорбиновой кислоты в кишечнике. Метаболизируется аскорбиновая кислота преимущественно в печени в дезоксиаскорбиновую, далее в щавелевоуксусную и дикетогулоновую кислоты. Выводится почками, через кишечник, с потом, грудным молоком в неизмененном виде и в виде метаболитов. Продуктами биотрансформации бендазола в крови являются два конъюгата, образующиеся вследствие метилирования и карбоэтоксилирования иминогруппы имидазольного кольца бендазола: 1-метил-2-бензилбензимидазол и 1-карбоэтокси-2-бензилбензимидазол. Метаболиты бендазола выводятся с мочой. Альфаглутамил-триптофан под воздействием петидаз расщепляется на L-глутаминовую кислоту и L-триптофан, которые используются организмом в синтезе белка.

Показания к применению:

Профилактика и комплексная терапия гриппа и острых респираторных вирусных инфекций у детей от одного года.

Противопоказания:

гиперчувствительность к компонентам препарата, сахарный диабет, беременность, детский возраст до 1 года. В случае необходимости, пожалуйста, проконсультируйтесь с врачом перед приемом препарата.

Меры предосторожности при применении.

Проконсультируйтесь с врачом перед приемом препарата, если у Вас артериальная гипотензия.

Применение при беременности и в период грудного вскармливания:

в период беременности прием препарата не рекомендуется в связи с недостаточными клиническими данными. В период грудного вскармливания применение возможно, если предполагаемая польза для матери превышает потенциальный риск для ребёнка. В случае необходимости приема препарата в период грудного вскармливания, пожалуйста, проконсультируйтесь с врачом.

Способ применения и дозы:

Внутрь за 30 мин до еды.

Для лечения:

Детям в возрасте от 1 до 3 лет – по 2 мл 3 раза в день; детям в возрасте от 3 до 6 лет – по 4 мл 3 раза в день; детям в возрасте от 6 до 10 лет – по 8 мл 3 раза в день; детям в возрасте старше 10 лет – по 12 мл 3 раза в день.

Курс применения – 4 дня. Если через 3 дня лечения улучшения не наступает или симптомы усугубляются, или появляются новые симптомы, необходимо проконсультироваться с врачом.

Для профилактики:

– при непосредственном контакте с больным гриппом и другими ОРВИ:

Детям в возрасте от 1 до 3 лет – по 2 мл 3 раза в день; детям в возрасте от 3 до 6 лет – по 4 мл 3 раза в день; детям в возрасте от 6 до 10 лет – по 8 мл 3 раза в день; детям в возрасте старше 10 лет – по 12 мл 3 раза в день.

Курс применения – 4 дня.

Профилактические курсы, при необходимости, повторяют через 3 недели (до нормализации эпидемической обстановки).

Побочное действие:

возможно кратковременное снижение артериального давления. Возможны аллергические реакции: крапивница. В этих случаях применение препарата прекращают и назначают симптоматическое лечение, антигистаминные средства.

Проконсультируйтесь с врачом, если у Вас проявились упомянутые побочные эффекты или другие побочные эффекты, не указанные в инструкции. Если побочные эффекты, указанные в инструкции, усугубляются, сообщите об этом врачу.

Передозировка:

Случаи передозировки не описаны.

Взаимодействие с другими лекарственными средствами:

Взаимодействие альфа-глутамил-триптофана с лекарственными средствами не выявлено.

Бендазол препятствует увеличению общего периферического сопротивления сосудов, обусловленному применением неселективных бета-адреноблокаторов. Усиливает гипотензивное (снижение артериального давления) действие гипотензивных и диуретических лекарственных средств. Фентоламин усиливает гипотензивное действие бендазола.

Аскорбиновая кислота повышает концентрацию в крови антибактериальных препаратов тетрациклинового ряда и бензилпенициллина. Улучшает всасывание в кишечнике препаратов железа (Fe). Снижает эффективность гепарина и непрямых антикоагулянтов. Ацетилсалициловая кислота (АСК), пероральные контрацептивы, свежие соки и щелочное питье снижают ее всасывание и усвоение. При одновременном применении с АСК повышается выделение с мочой аскорбиновой кислоты и снижается выделение АСК. АСК снижает абсорбцию аскорбиновой кислоты примерно на 30%. Аскорбиновая кислота увеличивает риск развития кристаллурии при применении препаратов, содержащих ацетилсалициловую кислоту (АСК) и сульфаниламидами короткого действия, замедляет выведение почками кислот, увеличивает выведение лекарственных средств имеющих щелочную реакцию (в т.ч. алкалоидов), снижает концентрацию в крови пероральных контрацептивов. При одновременном применении уменьшает хронотропное действие изопреналина. Уменьшает терапевтическое действие антипсихотических лекарственных средств (нейролептиков) – производных фенотиазина, канальцевую реабсорбцию амфетамина и трициклических антидепрессантов. Барбитураты и примидон повышают выведение аскорбиновой кислоты с мочой.

Возможно одновременное применение с противовирусными препаратами и средствами симптоматической терапии гриппа и ОРВИ.

Проконсультируйтесь с врачом, если Вы принимаете указанные в разделе или другие препараты.

Особые указания:

после повторного курса рекомендован контроль концентрации глюкозы в крови.

Влияние на способность управлять транспортными средствами, механизмами:

препарат не влияет на способность управлять транспортными средствами, работать с движущимися механизмами и заниматься другими потенциально опасными видами деятельности, требующими повышенной концентрации внимания и быстроты психомоторных реакций.

Форма выпуска:

Сироп [для детей]. По 50 мл во флаконе темного стекла. Флакон укупоривают пластмассовой крышкой с контролем первого вскрытия или пластмассовой крышкой с контролем первого вскрытия и защитой от детей.

По одному флакону помещают в пачку из картона.

Инструкцию по применению вкладывают в пачку или в виде сложенного листка помещают под открывающуюся часть этикетки. В пачку вкладывают дозирующее устройство: мерный стаканчик или ложку дозировочную, или пипетку дозировочную.

Условия хранения:

Хранить при температуре не выше 25 Сo. Хранить в недоступном для детей месте.

Срок годности:

2 года. Не использовать по истечении срока годности, указанного на упаковке.

Условия отпуска:

отпускают без рецепта.

Производитель / юридическое лицо, на имя которого выдано регистрационное удостоверение/ организация, принимающая рекламации по качеству препарата:

Акционерное общество «Медико-биологический научно-производственный комплекс «Цитомед» (АО «МБНПК «Цитомед»).

Адрес: Россия, 194356, г. Санкт-Петербург, Орлово-Денисовский проспект, дом 14, строение 1, тел. : 8 (800) 505-03-01,

cytomed.ru

Адрес производственной площадки:

Россия, г. Санкт-Петербург, г., Орлово-Денисовский проспект, дом 14, строение 1.

Генеральный директор А.Н. Хромов АО «Медико-биологический научно-производственный комплекс «Цитомед»

Изучение эффективности аэрозольного применения препарата «Тривирон» в отношении вируса инфекционного бронхита кур

Механизм противовирусного действия препарата «Тривирон» основан на разрушении РНК вирусных частиц с помощью низкомолекулярной искусственной рибонуклеазы (artificial ribonucleases).

Доказано, что гидролиз РНК под действием химически синтезированных рибонуклеаз протекает аналогично гидролизу РНК под действием панкреатических РНК-аз. Свойства таких искусственных РНК-аз используются в препарате «Тривирон», обуславливая его противовирусную активность. Еще одним важным свойством, которым обладают искусственные рибонуклеазы, является каталитический характер их действия, т. е. искусственные рибонуклеазы могут действовать многократно – одна молекула РНК-азы может разрушить много молекул РНК, что позволяет использовать противовирусный препарат «Тривирон» в низких дозах.

Для борьбы с респираторными РНК-вирусами была разработана схема аэрозольного применения противовирусного препарата «Тривирон». Аэрозольное применение препарата санирует носовые ходы, трахею и бронхи от возбудителей РНК-вирусных инфекций, в т. ч. и от метапневмовирусной инфекции (МПВИ), а также способствует инактивации вирусных частиц в воздухе. Так как МПВИ является «доза-зависимой» инфекцией, то даже незначительное снижение концентрации вируса в воздухе может иметь клиническое значение.

1. Результаты электронной микроскопии. Частицы вируса гриппа, не обработанные РНКазами

2. Результаты электронной микроскопии. Частицы вируса гриппа, обработанные РНКазами

 

Материалы и методы

Исследования проводили на базе лаборатории фармакогеномики Института химической биологии и фундаментальной медицины СО РАН и сектора молекулярной биологии Института экспериментальной ветеринарии Сибири и Дальнего Востока СФНЦА РАН.

Цыплят-бройлеров кросса Hubbard F15 в возрасте двух недель заражали вакцинным штаммом вируса инфекционного бронхита кур IB 4-91 (в составе живой аттенуированной вакцины Nobilis IB4-91, производство Intervet). Цыплятам аэрозольно была введена вакцина в расчете 1 доз на одну голову. Средний диаметр капли – 1,13 мкм, экспозиция – 3 мин.

Аэрозольная камера

Цыплята были разделены на четыре опытные (по шесть голов) и одну контрольную (семь голов) группы. Через три часа после заражения цыплят опытных групп подвергали аэрозольной обработке противовирусным препаратом «Тривирон» с экспозицией 1, 2, 4 и 6 мин. Курс лечения составил три обработки (по одной обработке в сутки).

Для контроля биодоступности аэрозоля перед завершением эксперимента (через три часа после последней обработки) цыплятам опытных групп вводили аэрозоль контрольного вещества «Aritest» с той же экспозицией, что и препарат «Тривирон».

Объем аэрозольной камеры был 111 12 см3 (с учетом объема оборудования в камере ~ 1 м3). Расход подготовленного для аэрозольного распыления рабочего раствора препарата «Тривирон» (рабочий раствор препарата «Тривирон» – это препарат «Тривирон», разведенный с водой в 1 раз) составил 3 мл/м3. Генерацию аэрозоля осуществляли с использованием компрессорного небулайзера Microlife. Средний диаметр капли – 1,13 мкм.

 Компрессорный небулайзер Microlife

 

Результаты собственных исследований и их обсуждение

Разработка схемы аэрозольной терапии

На первом этапе исследования была разработана и оптимизирована схема подготовки противовирусного препарата «Тривирон» для его аэрозольного применения птице, т. к. для стабилизации действующего вещества и предотвращения его адсорбции на стенках емкостей в составе препарата содержится муравьиная кислота.

После разведения препарата в дистиллированной воде в соотношении 1:1 добавляют компоненты для нейтрализации муравьиной кислоты, содержащейся в препарате, и глицерин, который позволяет стабилизировать размер капли при получении аэрозоля.

При аэрозольной обработке рабочим раствором препарата «Тривирон» цыплята вели себя аналогично тому, как и при их аэрозольной обработке дистиллированной водой в смеси с глицерином (контроль). После завершения обработки поведение цыплят не отличалось от их состояния, кото­рое было у них перед обработкой аэрозолем.

Испытание аэрозольной терапии противовирусным препаратом «Тривирон» на модели заражения двухнедельных цыплят десятикратной дозой вакцинного штамма вируса ИБК.

Цыплята в аэрозольной камере

 

Предварительное тестирование трахеи у цыплят в возрасте одних–трех суток методом ПЦР на наличие геномной РНК вируса инфекционного бронхита кур показало отсутствие вируса у большинства цыплят (было положительно три пробы у девяти цыплят в возрасте одних–трех суток). Это свидетельствует, что наличие трансовариальных антител в большинстве случаев препятствует вакцинации цыплят в первые дни жизни. В зарубежной литературе случаи заражения суточных цыплят, полученных от привитого родительского стада, также не были обнаружены.

 Аэрозольное распыление препарата «Тривирон»

 

В связи с этим была предложена модель инфекции ИБК путем аэрозольного заражения цыплят десятикратной дозой вакцинного вариантного штамма ИБК. Для этого использовали живую аттенуированную вакцину Nobilis IB4-91, производство Intervet.

Размер капли аэрозоля (1,13 мкм) был оптимален для попадания вируса в бронхи и трахею, т. е. в отличие от спрей-вакцинации мы обеспечили сразу попадание значительной дозы вируса ИБК в чувствительные к заражению ткани птицы, что должно было обеспечить эффект переболевания.

Факт гибели 28,5% цыплят в контрольной группе и 16% цыплят в группе, получавшей минимальную дозу противовирусного препарата «Тривирон» (за счет меньшей экспозиции), а также наличие воспалительной реакции в легких и трахее у птиц во всех группах позволяет говорить об успешности предложенной модели инфекционного процесса.

Как следует из табл. 1, при использовании противовирусного препарата «Тривирон» удается повысить выживаемость цыплят на 28% (при экспозиции более 1 мин.) и снизить встречаемость пневмоний на 6% (при экспозиции 4 мин. и более).

По результатам ПЦР вирус инфекционного бронхита кур встречался во всех группах, что подтверждает успешность заражения вирусом ИБК. Однако вирус ИБК был обнаружен не в каждой пробе трахеи, что может быть обусловлено как разрушением эпителия трахеи, так и наличием гуморального иммунитета у части цыплят после первой вакцинации (по нашим наблюдениям, до 3–4% цыплят могут сформировать гуморальный иммунитет после вакцинации в суточном возрасте).

   

Легкие цыпленка из опытной группы

с экспозицией 6 мин.

 

Цыпленок из контрольной группы.

Легкие серого цвета, сосуды более кровенаполненные

 

 

Трахея у цыпленка из опытной
группы с экспозицией 4 мин.
Пневмония есть, но трахея чистая

 

Интересным фактом является то, что в ряде случаев в опытных группах при наличии пневмонии наблюдались абсолютно здоровые трахея и бронхи. Учитывая, что размер частиц аэрозоля позволял санировать трахею и бронхи, но не легкие, можно допустить, что в месте попадания противовирусного препарата «Тривирон» на слизистую оболочку трахеи и бронхов наблюдается защитный эффект.

Вывод

Аэрозольное применение противовирусного препарата «Тривирон» повышает выживаемость цыплят при респираторной форме инфекционного бронхита кур (на 28% при экспозиции более 1 мин.) и снижает возникновение пневмоний (на 6% при экспозиции 4 и более мин.).

 

ZooRing корм для взрослых кошек Цыпленок в Кирове

Чикен Эдалт Кэт Профессионал – корм предназначен для взрослых кошек всех пород с учётом особенностей их развития – поддерживает питомца в отличной форме.

Высококачественные мясные ингредиенты обеспечивают полноценное насыщение организма животного.

Формула красоты для шерсти и кожи заботиться об экстерьере.

Пребиотики способствуют восстановлению и поддержанию микрофлоры кишечника.

В состав корма входят высококачественные белки животного происхождения с высокой степенью усвояемости.

Жирные кислоты ОМЕГА-3 и ОМЕГА-6 влияют на процессы роста, развития, выработку энергии.

Таурин – незаменимая аминокислота, необходимая для хорошего зрения, нормального функционирования сердца, головного мозга и периферийной нервной системы.

Добавлены яблоки, как источник натуральных витаминов, минералов и аминокислот, а также как мочегонное средство профилактирующее заболевания мочеполовых путей.

Наличие в составе витаминно-минерального комплекса и аминокислот укрепляет иммунную систему и профилактирует многие заболевания.

Юкка Шидигера, обладающая противовоспалительным, антибактериальным, противовирусным эффектами, уменьшает запах изо рта.

В составе корма

Высококачественные протеины животного происхождения

Насыщенность

пребиотиками

Профилактика МКБ и волосяных комков в желудке

Жирные кислоты

OMEGA 6:3

Состав

Обезвоженное мясо 35% (в том числе птица, индейка не менее 5%, рыба 4%), отруби пшеничные, жир птицы, гидролизованные мясные белки, маис, обезвоженный концентрат дрожжей, рыбий жир лосося, яблоки сушенные, Юкка Шидигера 300 мг/кг, таурин 0,12%/1 кг, токоферол.

Витаминно-минеральный комплекс

Добавки на 1 кг

Витамин A – 18 000 ME

Витамин D3 – 1500 ME

Витамин E – 300 мг

Витамин B1 – 5,0 мг

Витамин B2 – 6,0 мг

Ниацин – 60 мг

Витамин В6 – 6,0 мг

Витамин В12 – 0,04 мг

Пантотеновая кислота – 10,0 мг

Фолиевая кислота – 1,0 мг

Хлорид холина – 1800 мг

Биотин – 0,2 мг

Витамин К – 0,1 мг

Минералы и аминокислоты

Кальций – 1,35%

Фосфор – 0. 96%

Натрий – 0,3%

Калий – 0,6%

Лизин – 2.83%

Метионин+цистин – 1,5%

Триптофан – 0,2%

Аналитический состав

Влага не более – 8%

Сырой протеин – 30,0%

Сырой жир – 16,0%

Сырая клетчатка – 2,5%

Углеводы – 37,0%

Минеральные добавки на 1 кг

Железо: Сульфат железа, моногидрат – 50 мг

Марганец: Оксид марганца – 10 мг

Меди: Сульфат меди, пентагидрат – 10 мг

Цинк: Сульфат цинка, моногидрат – 90 мг

Йод: Йодат кальция, безводный – 1,3 мг

Селен: Селенит натрия – 0,1 мг

Протеин – 30%, Жир – 16%, Клетчатка – 2,11%, Сырая зола – 6,5%.

Энергетическая ценность: 4000 ккал/кг.

Суточная норма:

Вес кошки, кг 1-2 2-3 3-4 4-5 5-6 7+
Норма кормления, г/в день 40-45 45-67 67-90 90-109 109-115 128+

Норма кормления индивидуальна в зависимости от подвижности питомца.

Корм следует вводить в течение 5-10 дней.

У кошки всегда должна быть свежая питьевая вода.

Россия

Цыпленок по-грузински – Коммерсантъ Нижний Новгород

Когда у нас говорят и в особенности пишут про ресторан, что еда в нем «как дома»,— это чаще всего не комплимент. Имеется в виду в целом неплохая, но простоватая, тяжеловатая и поданная без изысков еда — так, мол, и у тещи на кухне можно поесть, а в заведения ходят за другими блюдами. Совсем иной подход в Италии. Про самую лучшую ресторанную пасту скажут: ну, она почти, как у бабушки,— в том смысле, что дома, разумеется, лучше, но эта приближается. Похожая картина во Франции: сколько там ресторанов Chez Maman или Chez Grand Maman. И это на самом деле, как и в Италии, семейные заведения, которые переходят от бабушек к внукам. Самая знаменитая «мамаша» — Эжени Бразье, первая и главная учительница Поля Бокюза, которая получила шесть мишленовских звезд, то есть каждый из двух ее ресторанов обладал тремя. Разумеется, наряду с семейными заведениями во Франции огромное количество ресторанов высокой кухни, но многие звездные шефы вышли из харчевен с домашней едой.

В России все сложилось иначе. Почти весь XX век большей части населения СССР было не до изысков. В начале 70-х говядина вообще исчезла из свободной торговли, свинина состояла почти только из сала, а баранина — из костей и жил. А знаменитые куры советских времен — синие «птицы счастья»? Сколько анекдотов родилось от одного их вида. Или вот еще советская народная мудрость: лучшая рыба — это колбаса. Многие до сих готовят дома по тетрадкам своих мам и бабушек, живших в эпоху тотального дефицита. Скажем, набивают перцы вареным рисом, смешанным с обжаренным мясным фаршем, а потом все это еще целый час тушат. Когда-то переваренный рис был нужен, чтобы увеличить объем и смягчить текстуру жилистого мяса. Фаршированные перцы традиционно готовят на юге Франции совсем иначе. Их разрезают пополам, слегка обмазывают оливковым маслом, выкладывают на противень срезом вниз и немного обжигают в духовке. Затем фаршируют сырым или слегка припущенным фаршем из прекрасной говядины или баранины, смешанным с обжаренным луком, чесноком, мелко порубленными томатами и небольшим количеством сухарной крошки. Выкладывают на противень, поливают оливковым маслом и быстро подрумянивают в горячей духовке. Мясо остается сочным, а перцы не теряют цвета и не расползаются. Они просто великолепны на вкус с острым домашним томатным соусом, приправленным свежей зеленью.

Советская Грузия всегда была одной из немногих республик на пространстве СССР, где сохранялся культ хорошей повседневной еды. Здесь и сейчас, как в Италии, про лучшие рестораны говорят: почти как дома. Даже в самые несытые времена здесь готовили вкуснейшие блюда с большим количеством свежей зелени. Она испокон веков лежит на столе просто пучками, и в каждом блюде есть или тархун, или мята, или риган, кинза, базилик. Сложные и богатые традиционные грузинские соусы, которые можно подъедать, вытирая тарелку хлебом, напоминают не советские подливы, а индийские карри. Душа этих соусов — знаменитая сухая приправа уцхо-сунели. Это вовсе не смесь, как думают многие, а одна лишь травка с ярким, сильным ароматом — голубой пажитник. Вообще пажитник — частый гость в индийской кухне, но там используют желтый вариант (другие его названия — фенугрек и шамбала). Без уцхо-сунели не приготовить любимого у нас дома цыпленка по-грузински.

Это моя вариация на тему двух грузинских блюд — цыпленка тапака и цыпленка чкмерули. Раньше по выходным я часто готовила тапака (от слова «тапа» — по-грузински сковорода, то есть цыпленок, жаренный на сковороде). Вкусно — но уж очень невыгодная вещь (мясо даже в лучших тбилисских ресторанах подсушивается по всем краям, и остаются одни куриные «семечки»). Поэтому я стала готовить ближайших «родственников» тапака — чкмерули (чкмерули значит «из Чкмери», есть такое село в Грузии): после быстрой обжарки цыпленка-корнишона на глиняных сковородках кеци на углях (прекрасно получается и на сковородке с тяжелым дном на обычной плите) его немного томят в соусе — он доходит и не пересушивается. В соус традиционно кладут только чеснок и воду, иногда зеленый перец и кинзу. Но блюдо выходит еще насыщеннее, если заменить воду нежирным куриным бульоном и влить немного сливок. И еще я добавляю много кинзы и тархуна, которые дают поразительно свежий, даже пьянящий аромат. И готовка — просто элементарная.

Цыплят надо разрезать по линии хребта или по линии груди и расплющить так, чтобы каждая птичка целиком укладывалась в сковородку. Через пищевую пленку неагрессивно отбить (чтобы кожа хорошо зарумянилась, тушку надо сделать как можно более плоской). Подсушить бумажным полотенцем и обмазать смесью из перца красного, перца черного, соли и оливкового масла. Оставить на 20 минут, чтобы цыплята подмариновались. Разогреть в сковородке постное масло, выложить первого цыпленка кожей вверх и закрыть тарелкой. Жарить, прижимая тарелку грузом на средне-сильном огне, до румяной корочки минут 7–10 (очень удобно на пресс-гриле). Перевернуть, опять накрыть, поставить гнет, уменьшить огонь и готовить еще столько же. Точно так же подготовить оставшихся цыплят. Тем временем нарежьте кинзу и тархун (в нем используйте только листочки). В ступке разотрите чеснок с солью и уцхо-сунели, переложите получившуюся пасту в широкий сотейник, влейте бульон и немного сливок, добавьте половину зелени, все размешайте. Поджаренных цыплят разрежьте пополам, опустите в соус и прикройте крышкой — на среднем огне нужно довести до кипения, снизить огонь и потомить 10 минут. В конце добавьте оставшуюся зелень и подавайте с подсушенными лепешками типа армянского лаваша.

Я очень люблю рестораны, но вот такой цыпленок по-настоящему выходит только на домашней кухне. В ресторане его нужно готовить заранее, охлаждать, делить на порции, вакуумировать, разогревать при поступлении заказа — получается не совсем то. К тому же хорошая свежая зелень и настоящий фермерский цыпленок так увеличивают себестоимость, а значит, и цену блюда в меню, что его вряд ли станут заказывать. Дома вы можете себе это позволить. Тем более что на дворе осень, вирус опять атакует, веселых вечеринок не предвидится. А цыпленок по-грузински — зеленый духоподъемный праздник в вашей тарелке.

chekalova.ru

О пользе куриного бульона

В переводе с французского языка слово «бульон» означает «вода, прокипячённая с мясом». Поэтому, очень важно, какое именно мясо будет использовано для приготовления бульона. Современные специалисты в области питания выяснили, что мясо кур по многим показателям превосходит другие виды мяса (подробнее – ссылка на статью о пользе куриного мяса). Но обычный бройлерный цыпленок или замороженные импортные окорочка – не лучший выбор для приготовления настоящего куриного бульона. Эти продукты содержат излишний жир (который при варке превращается в хлопья, так как содержит неплавкие фракции), передают бульону «пустой» вкус и придают не слишком богатый аромат. Лучший бульон получится из суповой курицы (курицы-несушки). А именно она, на первый взгляд не такая крупная и красивая, как бройлерная, является главным секретом в создании наваристого, ароматного и полезного бульона.

Пожалуй, ни одно средство не оказывает лучшей помощи при борьбе с болезнями, чем куриный бульон. Его восстановительные свойства известны всем, кто хоть раз болел. И если в давние времена больных людей кормили куриным бульоном скорее по традиции, то в наши дни существует научно обоснованное подтверждение целесообразности такого питания при множестве заболеваний.

Приготовленный в домашних условиях свежий куриный бульон значительно улучшает проходимость бронхов при вирусных и простудных заболеваниях. Аминокислота цистеин способствует разжижению мокроты намного лучше, чем традиционные лекарственные препараты, дающие побочные эффекты. Целебное сочетание горячего бульона, жировых веществ и пряных приправ благотворно влияет на дыхательные пути. Эффективность бульона во время эпидемий простудных заболеваний повысит добавление в него небольшого количества тертого чеснока, антисептические, бактерицидные и противовирусные свойства которого известны всем.

Куриный бульон чрезвычайно полезен и при заболеваниях желудочно-кишечного тракта. Экстрактивные вещества, входящие в его состав, усиливают выделение желудочного сока, повышают кислотность, заставляя желудок работать интенсивнее.

Свежий куриный бульон полезен также при заболеваниях сердечно-сосудистой системы, так как в нем содержатся вещества, значительно снижающие уровень холестерина в крови и способствующие нормализации давления. Куриный бульон снижает вязкость крови, предотвращая образование тромбов. Содержатся в нем и пептиды, которые способствуют восстановлению поврежденных тканей, внутренних органов и заживлению ран.

Как приготовить идеальный куриный бульон?

Возьмите охлажденную или полностью размороженную суповую курочку. Для бульона из одной курицы потребуется 100г репчатого лука, 80 г моркови, пучок зелени, 5—6 горошин душистого перца, 2—3 лавровых листа, 4—5 шт. гвоздики, соль.

Курицу целиком или разделанную на кусочки кладут в холодную воду и доводят до кипения на слабом огне. Как только бульон начнет закипать, постепенно уменьшайте огонь – так, чтобы в итоге он кипел, но едва заметно. Здесь прямая зависимость – чем тише огонь – тем вкуснее и прозрачнее будет бульон. Тщательно снимают пену и излишний жир.
Когда мясо дойдет до готовности, вынимайте курицу из бульона и отделяйте мясо от кости. Оставшиеся косточки и корпус продолжайте варить для большей крепости бульона. Всего бульон варится 2—3 часа.

За полчаса – час до конца варки добавьте коренья, морковь, репчатый лук, стебли сельдерея и другие пряности по вкусу. Все пряности можно сложить в марлевый мешочек и опустить в кастрюлю, тогда в конце их будет очень легко удалить.

Добавьте хорошо вымытую луковицу в кожуре (или луковую шелуху), если Вы хотите получить бульон приятного золотисто-коричневатого цвета. А свежая зелень может окрасить его в зеленый цвет. Бульон обычно получается прозрачный и остается его только процедить.

В бульонные чашки положить кусок курицы и залить горячим бульоном. Также по вкусу можно добавить половинку вареного яйца, зелень, молотый перец. Подавать с гренками или пирожками с мясной начинкой.

Приятного аппетита!

Можно ли сделать куриный бульон еще полезнее? Конечно, да! Фантазируйте, смело добавляйте в бульон любимые овощи, зелень: морковь, репу, пастернак, стебли сельдерея, лук-порей, укроп, петрушку… Для повышения пользы этого великолепного блюда очень важно минимизировать использование соли. Вот такой простой секрет приготовления нежирного диетического куриного бульона!

Противостоять вирусам поможет Эндовираза

С. Живодеров

А. Рябова

Endoviraza will help to resist to viruses

S. Zhivoderov

A. Ryabova

Октябрь 2015


Птицеводство

Скачать статью в PDF

Подписаться на журнал

Препарат Эндовираза обладает противовирусным эффектом в отношении вируса ИЛТ птиц: аэрозольная обработка цыплят защищает от заражения.

Ключевые слова:

птицеводство,
птица,
вирус,
антибиотик,
профилактика,
продуктивность,
эпизоотическая вспышка,
возбудитель,
патоген,
вакцинация,
иммунизация,
инфекционный ларинготрахеит (ИЛТ),
падёж,
яйцо,
цыпленок,
бройлер,
Эндовираза,
эндонуклеаза бактериальная,
единица активности,
магний сернокислый,
аэрозольная обработка,
сохранность,
летальность,
противовирусный эффект

Antiviral product Endoviraza possesses effect against poultry ILT virus: aerosol treatment of chicks protects them from infection.

Кeywords:

poultry production

poultry

virus

antibiotic

disease prevention

productivity

epizootic outbreak

disease agent

pathogen

vaccination

immunization

infectious laryngotracheitis (ILT)

die-off

egg

chick

broiler

Endoviraza

bacterial endonuclease

activity unit

magnesium sulfate

aerosol treatment

viability

death rate

antiviral effect.

2019-12-23

ИД «Животноводство»

[email protected]

Москва,
Хорошевское шоссе, 32 А, оф. 8

+7 901 578-71-29

8 800 551-73-54

MB-1® — надежная защита и безопасность

Для защиты птицы от ИББ и ньюкаслской болезни целесообразно использовать эффективную и проверенную вакцину MB-1 компании Phibro Animal Health Corporation.

Использование подстилки в птичнике

Грамотное использование подстилочных материалов на птицеводческих предприятиях позволяет сохранить здоровье бройлеров и поддерживать их продуктивность на высоком уровне.

НаБиКат с хелатом кремния

Опыт подтвердил эффективность применения в кормлении кур-несушек хелата кремния, входящего в состав полидобавки НаБиКат.

Пептидогликаны: кишечный «мусор»

Расщепление провоспалительных пептидогликанов до противовоспалительных мурамилдипептидов предотвращает возникновение нежелательных воспалительных процессов в организме птицы и способствует повышению эффективности ее выращивания.

Обходим подводные камни

Грамотный подход к кормлению птицы позволяет существенно увеличить приросты живой массы бройлеров и яйценоскость кур, улучшить конверсию корма и качество получаемой продукции и тем самым повысить рентабельность предприятия.

Профилактика болезни Гамборо

Вакцинация методом in ovo позволяет одновременно иммунизировать большое количество цыплят против болезни Гамборо, снизить нагрузку на персонал и оптимизировать затраты на выращивание птицы.

«ТехБро» — выбор в пользу экономики

При помощи программы «ТехБро» специалисты компании «Каргилл» разрабатывают кормовую стратегию непосредственно для конкретной птицефабрики, если скармливание комбикормов, приготовленных по типовым рецептурам, не приносит желаемого результата или экономически неэффективно.

«БигФармНет Менеджер»:цифровое управление производством«

Использование на птицефабриках программного комплекса «БигФармНет Менеджер» компании «Биг Дачмен» позволяет в режиме реального времени получать актуальную информацию с каждого птичника, отслеживать производственный процесс и оперативно реагировать в случае отклонения показателей продуктивности по

«Бабкок» — «несушка миллионеров»

Компания «Хендрикс Дженетикс» представляет кросс несушек «Бабкок Уайт», который уже много лет остается одним из наиболее выгодных в использовании яичных кроссов.

Семинар «ВитОМЭК» собрал птицеводов

В турецком городе Белек компания «ВитОМЭК» провела семинар на тему «Инновационные и эффективные решения в птицеводстве».

Почему содержать несушек «Ломанн» выгодно?

Содержание несушек кроссов «Ломанн» приносит птицефабрике дополнительную прибыль, что подтверждают производственные показатели и экономические расчеты.

Повышаем усвояемость рационов для бройлеров

Применение мультиэнзимной кормовой добавки КЕМЗАЙМ® XPF сухой производства компании «Кемин» позволяет сохранять продуктивность бройлеров на оптимальном уровне даже при скармливании рационов с пониженной питательностью.Применение мультиэнзимной кормовой добавки КЕМЗАЙМ® XPF сухой производства комп

Новый инкубатор Petersime X-Streamer™

X-Streamerтм производства компании Petersime — первый в мире интеллектуальный инкубатор, сочетающий встроенную интеллектуальную технологию, запатентованную технологию Embryo-Response Incubation™ и передовые конструктивные особенности.

Оборудование «Биг Дачмен» для эффективного птицеводства

Компания «Биг Дачмен» представляет современное оборудование для выращивания ремонтного молодняка и содержания родительского стада птицы.

Избежать насечки или боя поможет электронное яйцо

Уменьшить долю технологического брака яйца (бой и насечка) позволяет использование электронного яйца от компании «Коудайс МКорма».

CHICKEN ADULT CAT / Цыпленок

ОПИСАНИЕ

Чикен Эдалт Кэт Профессионал - корм предназначен для взрослых кошек всех пород с учётом особенностей их развития – поддерживает питомца в отличной форме.

 Высококачественные мясные ингредиенты обеспечивают полноценное насыщение организма животного.

 Формула красоты для шерсти и кожи заботиться об экстерьере.

 Пребиотики способствуют восстановлению и поддержанию микрофлоры кишечника.

 В состав корма входят высококачественные белки животного происхождения с высокой степенью усвояемости.

 Жирные кислоты ОМЕГА-3 и ОМЕГА-6 влияют на процессы роста, развития, выработку энергии.

 Таурин - незаменимая аминокислота, необходимая для хорошего зрения, нормального функционирования сердца, головного мозга и периферийной нервной системы.

 Добавлены яблоки, как источник натуральных витаминов, минералов и аминокислот, а также как мочегонное средство профилактирующее заболевания мочеполовых путей.

 Наличие в составе витаминно-минерального комплекса и аминокислот укрепляет иммунную систему и профилактирует многие заболевания.

 Юкка Шидигера, обладающая противовоспалительным, антибактериальным, противовирусным эффектами, уменьшает запах изо рта.

В составе корма

  • Высококачественные протеины животного происхождения
  • Насыщенность пребиотиками
  • Профилактика МКБ и волосяных комков в желудке
  • Жирные кислоты OMEGA 6:3
  • Сбалансированный комплекс витаминов и минералов
  • Юкка Шидигера – уменьшает запах изо рта и фекалий
  • Антиаллергенная формула – наличие злаковых минимально
  • Формула красоты для шерсти и кожи
  • Без ГМО, сои, химических ароматизаторов и красителей

Состав

Обезвоженное мясо 35% (в том числе птица, индейка не менее 5%, рыба 4%), отруби пшеничные, жир птицы, гидролизованные мясные белки, маис, обезвоженный концентрат дрожжей, рыбий жир лосося, яблоки сушенные, Юкка Шидигера 300 мг/кг, таурин 0,12%/1 кг, токоферол.

Витаминно-минеральный комплекс

Добавки на 1 кг

 Витамин A – 18 000 ME

 Витамин D3 – 1500 ME

 Витамин E – 300 мг

 Витамин B1 – 5,0 мг

 Витамин B2 – 6,0 мг

 Ниацин – 60 мг

 Витамин В6 – 6,0 мг

 Витамин В12 – 0,04 мг

 Пантотеновая кислота – 10,0 мг

 Фолиевая кислота – 1,0 мг

 Хлорид холина – 1800 мг

 Биотин – 0,2 мг

 Витамин К – 0,1 мг

Минералы и аминокислоты

 Кальций – 1,35%

 Фосфор – 0.96%

 Натрий – 0,3%

 Калий – 0,6%

 Лизин – 2.83%

 Метионин+цистин – 1,5%

 Триптофан – 0,2%

Аналитический состав

 Влага не более – 8%

 Сырой протеин – 30,0%

 Сырой жир – 16,0%

 Сырая клетчатка – 2,5%

 Углеводы – 37,0%

Минеральные добавки на 1 кг

 Железо: Сульфат железа, моногидрат – 50 мг

 Марганец: Оксид марганца – 10 мг

 Меди: Сульфат меди, пентагидрат – 10 мг

 Цинк: Сульфат цинка, моногидрат – 90 мг

 Йод: Йодат кальция, безводный – 1,3 мг

 Селен: Селенит натрия – 0,1 мг

Протеин – 30%, Жир – 16%, Клетчатка – 2,11%, Сырая зола – 6,5%.

Энергетическая ценность: 4000 ккал/кг.

Суточная норма:

Вес кошки, кг          Норма кормления, г/в день

1-2                            40-45

2-3                            45-67

3-4                            67-90

4-5                            90-109

5-6                            109-115

7+                              128+

Норма кормления индивидуальна в зависимости от подвижности питомца.

Корм следует вводить в течение 5-10 дней.

У кошки всегда должна быть свежая питьевая вода.

Внутренняя ложка о науке о курином супе и простуде • Изучите интегративную медицину

В этой статье:

Справка:

Хотя простуда является давней и часто встречающейся болезнью, остается много нерешенных вопросов, касающихся простуды. Тем не менее, научные исследования позволили нам лучше понять науку, лежащую в основе куриного супа, и возможные причины, по которым простуда более распространена в сезоны с более низкими температурами.Хотя по-прежнему ведутся споры о том, может ли простуда увеличить риск простуды, возможно, лучше сделать ошибку и согреться в это холодное время года.

Введение:

На протяжении веков куриный суп считался лекарством от простуды. Фактически, египетский еврейский врач и философ Маймонид в своем трактате XII века советовал людям употреблять куриный суп для облегчения симптомов респираторных заболеваний. Кроме того, ряд других культур использовали куриный суп в своих традиционных лечебных практиках для борьбы с простудой.В современном обществе даже принято использовать куриный суп как средство от простуды, но какова наука, стоящая за куриным супом? Читайте дальше, чтобы получить представление о простуде и научных доказательствах противостоящих свойств куриного супа.

Почему простуда чаще встречается в холодную погоду?

Хотя холод сам по себе не вызывает у людей простуду, сочетание следующих факторов может способствовать тому, почему простуды возникают чаще в осенний и зимний периоды:

  • Риновирусы (вирусы, вызывающие простуду) процветают при низких температурах. Согласно статье 2013 года в Nature News , исследователи признали этот факт на протяжении десятилетий [1] . Кроме того, в статье 2009 года, опубликованной в журнале Respiratory Medicine , сообщается, что в холодных условиях температура верхних дыхательных путей может быть более благоприятной для репликации риновирусов, что приводит к увеличению числа случаев простуды в периоды более низкой температуры [ 2] .
  • При низких температурах наши тела могут производить меньше антивирусных иммунных сигналов и делать нас более уязвимыми для инфекций. На конференции Американского общества микробиологов в 2013 году ученые из Йельского университета представили свое исследование, которое продемонстрировало, как низкие температуры могут поставить под угрозу естественную защиту от риновирусов. В своем исследовании с участием мышей и мышиноспецифического риновируса они обнаружили, что в более холодных условиях мыши производили меньше противовирусных иммунных сигналов, чем в более теплых условиях. Это снижение антивирусных сигналов позволило инфекциям легче сохраняться при более низких температурах. Кроме того, ученые провели исследование клеток дыхательных путей человека, выращенных в холодных или теплых лабораторных условиях, и заразили эти клетки риновирусами, вызывающими простуду у людей.Из этого исследования они продемонстрировали, что инфицированные клетки, выросшие в более теплой среде, подвергались запрограммированной гибели клеток (форма самоубийства клеток, возникающая в результате иммунного ответа, ограничивающего распространение инфекции) с большей скоростью, чем клетки, инфицированные в более холодной среде. [1] .
  • Холодные температуры и низкая влажность, характерные для «холодного» сезона, связаны с увеличением числа случаев острых инфекций дыхательных путей (включая такие состояния, как простуда) в соответствии со статьей 2009 Respiratory Medicine , упомянутой выше [2 ] . Кроме того, Министерство здравоохранения и социальных служб США: Национальный институт аллергии и инфекционных заболеваний (NIAID) объясняет, что вирусы, вызывающие простуду, лучше «выживают» при низкой влажности, которая бывает в более холодные месяцы. Кроме того, NIAID также сообщает, что холодная погода может сделать слизистую носа более сухой и более восприимчивой к вирусам, вызывающим простуду [3] .

Остаться в тепле, чтобы предотвратить простуду?

Может ли физическая простуда увеличить ваши шансы заболеть простудой? По этому поводу до сих пор ведутся споры, и исследователи сообщили о результатах, которые предлагают разные ответы на этот вопрос.

· Исследование 1968 года, опубликованное в журнале New England Journal of Medicine , обследовало 44 добровольцев на предмет экспериментально вызванных риновирусных инфекций и обнаружило, что воздействие низких температур (приблизительно от 39 до 50 ° F) не влияло на частоту или тяжесть простудных заболеваний, возникающих в результате штамм риновируса, использованный в исследовании [4] .

· Исследование 2005 года, опубликованное в Family Practice , продемонстрировало, что субъекты, у которых ноги охлаждались в ванне с холодной водой, с большей вероятностью сообщали о симптомах простуды через 4-5 дней после процедуры охлаждения по сравнению с контрольными участниками, у которых не было их ноги мерзли [5] .

Несмотря на неубедительный характер исследований взаимосвязи между воздействием низких температур и простудой, осторожным решением может быть просто согревание в холодное время года. Кроме того, доктор Ка-Кит Хуи, доктор медицины, основатель и директор Центра медицины Востока-Запада Калифорнийского университета в Лос-Анджелесе и профессор Уоллис Анненберг в области интегративной медицины Востока и Запада, уделяет большое внимание сохранению головы, шеи, плеч и стоп теплый, чтобы избежать ненужной потери тепла телом.

Наука за куриным супом

  • Противовоспалительный эффект:

Исследование 2000 года, опубликованное в CHEST , показало, что легкий противовоспалительный эффект, обеспечиваемый куриным супом, может быть одной из причин способности супа смягчать симптоматические инфекции верхних дыхательных путей, такие как простуда. Обычно, когда человек простужается, организм реагирует воспалением в верхних дыхательных путях.Воспалительная реакция, в свою очередь, сигнализирует о миграции лейкоцитов (WBC) в этот регион. Эта миграция лейкоцитов в верхние дыхательные пути может способствовать развитию часто встречающихся симптомов простуды, таких как заложенность носа. Когда исследователи измерили способность лейкоцитов мигрировать через фильтр из одной стороны камеры в другую, они обнаружили, что меньшее количество клеток мигрировало на другую сторону камеры в присутствии куриного супа. В результате ученые предполагают, что некоторые ингредиенты в супе могут быть ответственны за замедление или блокирование миграции этих лейкоцитов в верхние дыхательные пути и, таким образом, способствовать облегчению симптомов простуды.Тем не менее, из этого исследования куриного супа (приготовленного из ингредиентов, включая курицу, лук, сладкий картофель, пастернак, репу, морковь, сельдерей, петрушку, соль и перец), исследователи не смогли идентифицировать биологически активное соединение [6- 7] . Исследование 2012 года, опубликованное в American Journal of Therapeutics , показало, что соединение под названием карнозин, которое содержится в таких источниках, как куриный суп и куриная грудка, может помочь подавить провоспалительные состояния, обычно связанные с начальными стадиями вирусных инфекций, и предотвратить развитие простуды [8] .

  • Увеличение движения носовых жидкостей:

Хотя горячие жидкости обычно способствуют движению слизи из носа, куриный суп может превзойти горячую воду в увеличении движения слизи из носа, очищении дыхательных путей и ослаблении заложенности носа. Это понимание куриного супа основано на исследовании, в котором изучалась скорость слизи в носу у 15 здоровых людей, которые пили холодную воду, горячую воду или куриный суп. Результаты этого исследования (опубликованные в статье 1978 года в CHEST ) показали, что по сравнению с горячей и холодной водой горячий куриный суп приводит к увеличению скорости слизи в носу [9] .Кроме того, согласно отчету 1998 года из Coping with Allergies and Asthma , куриный суп может улучшить способность крошечных выступов на линии роста волос в носу (называемых ресничками) предотвращать заражение тела инфекционными частицами [10] .

Более пристальный взгляд на некоторые терапевтические ингредиенты:

· Чеснок: В исследовании 2001 года, опубликованном в журнале Advances in Therapy , в ходе двойного слепого плацебо-контролируемого эксперимента было продемонстрировано, что в группе, получавшей добавки с чесноком, было значительно меньше простудных заболеваний, чем в группе плацебо.Кроме того, при простуде те, кто получал чесночные добавки, выздоравливали быстрее, чем те, кто входил в группу плацебо [11] . Хотя детали, лежащие в основе способности чеснока проявлять противовирусные свойства, не совсем понятны, в обзоре 2009 года, опубликованном The Cochrance Library , говорится, что серосодержащие производные чеснока могут играть роль в его противовирусных эффектах [12] .

· Лук: Согласно обзору 2013 года, опубликованному в журнале Critical Reviews of Food Science and Nutrition , основным флавоноидом лука (соединение с антиоксидантным действием) является молекула, известная как кверцетин [13] .Кроме того, в исследовании 2005 года, опубликованном в журнале Федерации европейских биохимических обществ , сообщается, что кверцетин может проявлять противовирусные свойства [14] .

· Имбирь: Исследование 2013 года, опубликованное в журнале Journal of Ethnopharmacology , показало, что свежий имбирь эффективен против инфекций респираторно-синцитиального вируса человека (HRSV), которые вызывают широкий спектр респираторных заболеваний, включая простуду. Авторы сообщают, что свежий имбирь предотвращает заражение этим вирусом, блокируя прикрепление и интернализацию вируса [15] .

Эти данные о чесноке, луке и имбире могут пролить свет на научную основу давних методов борьбы с простудой, таких как следующие традиционные средства:

o 1-2 зубчика свежего чеснока, стакан кипятка и мед по вкусу

o от 1 до 2 унций. нижней белой части луковиц зеленого лука (зеленый лук), стакан кипятка

o несколько ломтиков свежего имбиря, стакан кипятка, мед по вкусу

Чтобы узнать больше о способах лечения и профилактики простуды, ознакомьтесь с Борьба с простудой в выпуске 2, том 12 Total Wellness.

Список литературы

1. «Вирусы простуды хорошо себя чувствуют в морозных условиях». nature.com/news. (2013).

2. «Низкая температура и низкая влажность связаны с увеличением числа инфекций дыхательных путей». Респ. Медицина . (2009).

3. «Простуда». niaid.nih.gov. (2011).

4. «Воздействие холода и риновируса обычной простуды – отсутствие эффекта». N Engl J Med. (1968).

5. «Острое похолодание стоп и появление симптомов простуды». Фам Практ . (2005).

6. «Куриный суп ингибирует хемотаксис нейтрофилов» In vitro. СУНДУК . (2000).

7. «Куриный суп действительно полезен от холода». abcnew.go.com. (2000).

8. «Лечение вирулентной инфекции вируса гриппа с помощью перорального препарата негидролизованного карнозина и изопептида карнозина, ослабляющего индуцированную провоспалительными цитокинами продукцию оксида азота».” Am J Ther. (2012).

9. «Влияние употребления горячей воды, холодной воды и куриного супа на скорость слизи в носу и сопротивление воздушному потоку через нос». СУНДУК . (1978).

10. «Куриный суп от аллергии и астмы». Как справиться с астмой и аллергией . (1998).

11. «Предотвращение простуды с помощью добавок чеснока: двойное слепое исследование, контролируемое плацебо». Adv Ther . (2001).

12. «Чеснок от насморка. Кокрановская библиотека. (2009).

13. «Лук: естественная защита от физиологических угроз». Crit Rev Food Sci Nutr . (2013).

14. «Модулирующие эффекты растительных фенолов на белки с множественной лекарственной устойчивостью человека 1, 4 и 5 (ABCC1, 4 и 5)». FEBS J. (2005).

15. «Свежий имбирь (Zingiber officinale) обладает противовирусной активностью против респираторно-синцитиального вируса человека в клеточных линиях дыхательных путей человека». J Ethnopharmacol. (2013).

Эта статья изначально была опубликована в журнале « Total Wellness Magazine» UCLA Student Wellness Commission. Щелкните здесь, чтобы просмотреть исходную статью, опубликованную в осеннем выпуске журнала Total Wellness за 2013 год. Для получения дополнительной информации о Total Wellness щелкните здесь, чтобы посетить их веб-страницу.

Шеннон Вонгвибулсин, кандидат бакалавра наук, UCLA 2014
Центр медицины Восток-Запад Калифорнийского университета в Лос-Анджелесе, штатный писатель

Противовирусная активность новой смеси природных противомикробных препаратов in vitro и на модели куриной инфекции in vivo

Вирусы и смесь противомикробных препаратов

Инфекционный бронхит (B1648) 39 , болезнь Ньюкасла (ATCC, 699), птичий грипп ( H9N2, ATCC, VR-1642) 40 , репродуктивно-респираторный синдром свиней (ATCC, VR-2386) и коронавирус крупного рогатого скота (ATCC, VR-874).Вирусы размножали в свободных от патогенов 10-дневных куриных яйцах с эмбрионами. В настоящих экспериментах использовали вирусы из второго пассажа. Через 48 часов после заражения аллантоисные жидкости собирали низкоскоростным центрифугированием и хранили при -70 ° C. В этом исследовании мы использовали коммерческий продукт (AuraShield L), смесь мальтодекстрина (4%) и хлорида натрия (0,5%). В качестве добавок также были включены молочная кислота (30%) и лимонная кислота (15%) и экстракт цитрусовых (8%), а 100% -ный баланс составляет dH 2 O.Эта коммерчески доступная смесь указана в рукописи AuraShield L, предоставленной Auranta LTD.

Анализ цитотоксичности (CC

50 , EC 50 и SI)

AuraShield L использовали для определения EC 50 и SI (селективный индекс). Смесь титровали от 1 до 1: 128 CC 50 и использовали для воздействия вируса. После добавления 10 мкл реагента МТТ (Sigma Aldrich) образцы инкубировали в течение 4 ч при 37 ° C. Концентрации ЕС 50 рассчитывали относительно концентраций экстракта.Для определения цитотоксической активности AuraShield L противомикробный продукт растворяли в воде и добавляли в среду для культивирования клеток до конечной концентрации 2%, чтобы количественно оценить влияние на монослойную культуру. Клетки Hep-2 (ATCC CCL-23) выращивали в минимальной необходимой среде Dubleco (DMEM – Sigma-Aldrich) с добавлением фетальной бычьей сыворотки до конечной концентрации 10%. Клетки инкубировали при 37 ° C, обновляя среду каждые 48 ч. Клетки Hep-2 выращивали в 0.001–0,2% среда, содержащая AuraShield L. Противомикробная смесь была испытана в трех повторностях и в трех разных случаях. Оптическую плотность каждой лунки измеряли при 620 нм в считывающем устройстве для микропланшетов (Fluostar Omega, BMG Labtech) и рассчитывали процент выживаемости клеток.

Прямой анализ бляшек

Анализ уменьшения бляшек выполняли, как описано ранее 41 . Brielfy, 2 × 10 3 бляшкообразующих единиц инкубировали с различными концентрациями AuraShield L в течение 2 часов при комнатной температуре.Серийные разведения обработанных вирусов адсорбировали на клетках в течение 2 ч при 37 ° C. Все анализы проводили в трех экземплярах. Инкубацию проводили в течение 4 дней при 37 ° C с последующей фиксацией 10% формалином. Подсчет налета проводили после окрашивания 1% кристаллическим фиолетовым.

Противовирусная активность in vitro

Противовирусная активность определялась, как описано ранее 41 , за исключением того, что в наших экспериментах использовалась линия клеток Hep-2. Вкратце, клетки Hep-2 были предварительно обработаны AuraShield L перед вирусным заражением, и отдельно вирусы инкубировали с AuraShield L перед заражением.Чтобы проверить всасывание или проникновение вируса, клетки и вирусы инкубировали вместе. AuraShield L всегда использовали в нетоксичной концентрации 0,09% и добавляли к клеткам с последующей инкубацией в течение 2 часов при 37 ° C. Супернатант удаляли, клетки промывали и инфицировали каждым вирусом индивидуально. В случае использования антимикробной смеси для предварительной обработки вирусов инкубация проводилась в течение 1 ч при комнатной температуре с последующим заражением клеток. Период абсорбции анализировали путем индивидуального смешивания вирусов с 0.09% AuraShield с последующим заражением клеток. В случае репликации после заражения инокулят удаляли и заменяли средой, содержащей 0,5% метилцеллюлозы. Каждый анализ выполняли в трех повторностях в трех разных случаях. Анализы уменьшения бляшек проводили, как указано выше, и количество бляшек клеток и вирусов, обработанных AuraShield L, сравнивали с необработанными контролями. Данные были подвергнуты статистическому анализу с использованием программного пакета Graph Prism.

In vivo инфекции IBV B1648

Двухнедельные бройлеры ROSS 308 были разделены на три группы (n = 150 бройлеров на группу): контрольная (C), первая экспериментальная группа (E1) включала бройлеров, зараженных IBV B1648 и второй эксперимент (E2) включал бройлеров, зараженных IBV B1648 и дополненных AuraShield L, как описано на рис.3. Все группы были вакцинированы против ИБК препаратами Biovac h220 (V1) и Nobilis IB491 (V2). Каждого бройлера в группах E1 и E2 интратрахеально инокулировали (200 мкл) 10 3 EID50 / 400 мкл B1648 на 14 день. AuraShield L вводили экспериментальной группе E2 через питьевую воду в соответствии с протоколом, описанным на рис. 3. Птиц содержали в отдельных изоляторах с отрицательным давлением, а питьевую воду и корм использовали в неограниченном количестве на протяжении всего эксперимента. Целью нашего исследования было оценить влияние Aura Shield L на частоту инфицирования и симптомы, и такое использование низкой контрольной дозы IBV сохраняет низкий уровень смертности, как описано ранее 39 .Контрольные бройлеры инокулировали 200 мкл PBS (фосфатный буферный раствор) и служили группой отрицательного контроля. На 28 день 30 цыплят из каждой группы были гуманно умерщвлены, а образцы трахеи и легких хранили при -70 ° C для количественного определения вирусной РНК с помощью RT-qPCR. Провоспалительные цитокины (TGF-β3, TNF-α, INFα, INFβ, INFγ) в ткани трахеи, легких цыплят, инфицированных IBV B1648, определяли с использованием коммерчески доступных систем твердофазного иммуноферментного анализа от Quantikine, R&D Systems.Результаты концентрации цитокинов выражали в пг (пикограммах) на миллилитр культуральной среды. Каждый запуск исследования проводился в трех экземплярах. План эксперимента был оценен и одобрен Комитетом по этике и благополучию животных Банатского университета сельскохозяйственных наук и ветеринарной медицины, король Майкл I из Румынии, Тимишоара, и мы подтверждаем, что все методы были выполнены в соответствии с соответствующими руководящими принципами и правилами.

Рисунок 3

Схематическое изображение дизайна эксперимента in vivo.Бройлеров вакцинировали на 5 день (V1) и 15 день (V2). Группы E1 и E2 заражались IBV B1648 на 14 день. Группа E2 получала AuraShield L с питьевой водой в течение 5 дней. На 28 день регистрировали продуктивность, и 30 бройлеров подвергали эвтаназии для анализа.

Оценка и клинические признаки

Клинические признаки, такие как взъерошенные перья, чихание, кашель, трахейные и легочные хрипы и одышка, регистрировались ежедневно в течение 5 дней применения AuraShield L и после того, как инфекция была установлена. Регистрировались клинические признаки и грубые поражения. Клинические признаки оценивали количественно и выражали в процентах от общего количества птиц. Процентная разница (уравнение 1) использовалась для определения эффективности AuraShield L в снижении клинических признаков заболевания.

$$ \% \, разница = \ frac {V1 – V2} {{\ left [{\ frac {V1 + V2} {2}} \ right]}} \ times 100 $$

(1)

RT-КПЦР тест для 1a гена ORF

Как ранее описан 39 RT-КПЦР праймеров были использованы для выявления штамма B1648 в образцах трахеи с использованием следующих праймеров cDNA_FW ggtgttaggcttatagttcctcag, cDNA_RV taaacattagggttgacaccagt, T7_FW taatacgactcactatagggggtgttaggcttatagttcctcag, qPCR_FW gctattgtagaggtagtgtatgtgag и qPCR_RV agggttgacaccagtaaagaat.Вирусную РНК выделяли из секрета трахеи с помощью набора RNeasy Plus Mini Kit (Qiagen, Великобритания). РНК подвергали обратной транскрипции с использованием набора Transcriptor First Strand cDNA Synthesis Kit (Roche) в соответствии с протоколом производителя. Уровни мРНК определяли количественной ОТ-ПЦР с использованием набора QuantiNovaSYBR Green PCR Kit (Qiagen, Великобритания) на LightCycler 96 (Roche). Условия для генов заключались в инкубации при 95 ° C в течение 8 мин, за которыми следовали 40 циклов, каждый по 10 с при 95 ° C и 60 с при 58 ° C.В каждой реакции использовали всего 5 мкл основной смеси SYBR Green вместе с 0,5 мкл 10 мкМ смеси праймеров, 3 мкл воды молекулярной чистоты и 1 мкл образца ДНК. Экстракты вирусной РНК из секретов трахеи анализировали в трех повторностях реакций RT-qPCR, как описано выше. Количественная оценка количества копий вирусной РНК в тканях (копий РНК / г) была аналогичной, как и в других образцах.

Определение уровней IgA в сыворотке

Общие уровни IgA измеряли с помощью набора для иммуноферментного анализа (ELISA) IgA (ab157691 ABCAM) в соответствии с инструкциями производителя.

Определения SCFA

SCFA анализировали с помощью газовой хроматографии, как описано ранее 42 . Вкратце, 1 г слепой кишки смешивали с 1 мл H 2 O и 1 мл раствора пивалиновой кислоты 20 ммоль / л в качестве внутреннего стандарта. Раствор перемешивали и добавляли 1 мл HClO 4 (хлорная кислота) для экстракции SCFA встряхиванием путем встряхивания в течение 5 мин. Кислоту HClO 4 осаждали добавлением 50 мл 4 моль КОН в 500 мл супернатанта.Добавление насыщенной щавелевой кислоты при 4 ° C в течение 60 минут и центрифугирование при 18000 g в течение 10 минут. Образцы анализировали с помощью газовой хроматографии с использованием SCION-456-GC с пламенно-ионизационным детектором.

Определение супероксид марганцевой дисмутазы (SOD2 / MnSOD) в легочной ткани

Супероксид марганецдисмутазы количественно определяли в легких и трахее с использованием набора SOD 2 Eliza для цыплят (аналитический раствор) в соответствии с инструкциями производителя. Вкратце, ткани промывали ледяным PBS (0.02 моль / л, pH 7,0–7,2) для удаления избытка крови, измельчили ткани на мелкие кусочки, гомогенизировали их в определенном количестве PBS и хранили при -80 ° C до дальнейшего использования. Стандартная кривая была построена для каждого эксперимента. Объемы 100 мкл образца и стандарта добавляли в каждую лунку 96-луночного планшета, за исключением контрольной лунки, куда добавляли 0,1 мл разбавителя для образца. Каждую лунку промывали промывочным буфером два раза, всего три промывки. После последней промывки промывочный буфер удаляли путем аспирации или перевертывания планшета и промокания его чистыми бумажными полотенцами.На следующем этапе в каждую лунку добавляли 100 мкл детектирующего антитела с последующей инкубацией при комнатной температуре в течение 2 часов. Затем в каждую лунку добавляли стрептавидин-HRP (100 мкл) и инкубировали при комнатной температуре в течение 30 минут. Каждое измерение проводилось в трех экземплярах.

Статистический анализ

Статистический анализ выполнялся с использованием программного обеспечения GraphPad. Данные были представлены как среднее ± стандартное отклонение. Статистически значимыми считались p-значения <0,05 (* p <0,05; ** p <0.01; *** p <0,001). Использовали ANOVA и Student t . ANOVA был выполнен для анализа процентного уменьшения по сравнению с контролем с использованием как двустороннего дисперсионного анализа ( p <0,0001), так и трехфакторного дисперсионного анализа ( p <0,0001).

Китайские птицеводы подвергаются критике за злоупотребление антивирусными препаратами

Вирус птичьего гриппа из-за чрезмерного употребления приобретает устойчивость к обычным лекарствам.

Штамм птичьего гриппа H5N1, которого так опасаются, стал устойчивым к одному из самых эффективных противовирусных препаратов – и, похоже, виновато использование этого соединения китайскими фермерами у кур.

На этой неделе обвинение было официально выдвинуто – и официально отвергнуто. Но в какой-то момент после 1997 года штамм H5N1 стал устойчивым к противовирусным препаратам семейства амантадин, и китайские официальные лица теперь пообещали расследовать это утверждение.

18 июня г. газета Washington Post сообщила, что китайские фермеры, поощряемые правительственными чиновниками, регулярно применяли амантадин для кур. Продовольственная и сельскохозяйственная организация Объединенных Наций (ФАО) и Всемирная организация здравоохранения (ВОЗ) затем допросили правительство Китая, которое опровергло сообщения, хотя официальные лица не комментировали, употребляли ли фермеры лекарства.

Координатор сети эпиднадзора за птичьим гриппом ФАО в Китае, Фушэн Го, сообщил агентству Nature , что эти препараты широко используются для борьбы с вирусами семейства H9 у кур. Го, который был частным консультантом китайских фермеров на протяжении 1990-х годов, говорит, что он предупреждал фермеров не использовать амантадин, потому что остатки в мясе могут сделать человеческие вирусы устойчивыми. Но в то время он не беспокоился об этом в отношении H5N1. «Теперь я считаю, что это серьезная проблема», – говорит он.

По словам Го, министерство сельского хозяйства, вероятно, не знало об использовании. «Продавцы знали, что это незаконно», – добавляет он.

Министерство здравоохранения Китая заявило ВОЗ 21 июня, что эта проблема «заслуживает самого пристального внимания», как заявил Рой Вадиа, официальный представитель ВОЗ в Пекине. Теперь потребуется наблюдение и тестирование, чтобы выяснить, насколько широко распространено его использование и насколько распространена резистентность к амантадину.

Первый штамм H5N1, заразивший людей в Гонконге в 1997 году, был чувствителен к амантадинам.Но устойчивость к ним, обнаруженная в 2003 году, оставила другое, более дорогое, семейство противовирусных препаратов, включая осельтамивир (продается как Тамифлю) и занамивир (Реленза), в качестве единственной линии защиты от вируса. Это оставляет бедные страны Юго-Восточной Азии без дешевого варианта.

Об этой статье

Цитируйте эту статью

Сираноски, D. Китайские птицеводы подвергаются критике за злоупотребление антивирусными препаратами.
Природа 435, 1009 (2005).https://doi.org/10.1038/4351009a

Ссылка для скачивания

Дополнительная литература

  • Одновременное определение пяти остатков противовирусных препаратов и исследования стабильности в меде с использованием двухэтапного захвата фракций в сочетании с тандемной масс-спектрометрией жидкостной хроматографии

    • Zhendong Wang
    • , Xinran Wang
    • , Yuhan Wang
    • , Cuiling Wu
    • и Jinhui Zhou

    Журнал хроматографии A
    (2021 год)

  • Разработанный рекомбинантный одноцепочечный вариабельный фрагмент моноклонального антитела обеспечивает защиту цыплят, инфицированных птичьим гриппом H9N2

    • Deimante Lukosaityte
    • , Jean-Remy Sadeyen
    • , Angita Shrestha
    • , Joshua E. Сили
    • , Сушант Бхат
    • , Пэнсян Чанг
    • , Пол Дигард
    • и Мунир Икбал

    Вакцины
    (2020)

  • Мотивы устойчивости к функциональным ингибиторам нейраминидазы у вирусов птичьего гриппа A (H5Nx)

    • Дагмара Бялы
    • и Холли Шелтон

    Антивирусные исследования
    (2020)

  • Анализ амантадина в ламинарии японской и морской воде острова Дацин с помощью сверхвысокопроизводительной жидкостной хроматографии с тандемной масс-спектрометрией с положительной ионизацией электрораспылением

    • Инцзян Сюй
    • , Чуанбо Рен
    • , Дяньфэн Хан
    • , Сянхун Гонг
    • , Сючжэнь Чжан
    • , Хуэй Хуан
    • , Фанг Цзян
    • , Янмэй Цуй
    • , Вэйюнь Чжэн
    • и Вэйюнь Чжэн

    Журнал хроматографии B
    (2019)

  • Воспроизводимый иммуночип поверхностного плазмонного резонанса для безметочного обнаружения амантадина в продуктах животного происхождения

    • Mingfei Pan
    • , Jingying Yang
    • , Shijie Li
    • , Wenjun Wen
    • , Junping Wang
    • , YuMei Ding
    • и Shuo Wang

    Методы анализа пищевых продуктов
    (2019)

Комментарии

Отправляя комментарий, вы соглашаетесь соблюдать наши Условия и принципы сообщества. Если вы обнаружите что-то оскорбительное или не соответствующее нашим условиям или правилам, отметьте это как неприемлемое.

(PDF) Контроль птичьего гриппа у домашних птиц с помощью противовирусных препаратов и молекулярных манипуляций

Суэйн Д. Э. и Капчински Д. (2008). Стратегии и проблемы для выработки иммунитета против вируса птичьего гриппа у

птиц. Immunological Reviews, 225, 314-331.

Суэйн, Д. Э., Паваде, Г., Гамильтон, К., Валлат, Б., и Миягишима, К. (2011). Оценка национальных стратегий

борьбы с высокопатогенным птичьим гриппом и низкопатогенным птичьим гриппом у домашней птицы, с упором на вакцины и вакцинацию

. Revue Scientifique et Technique, Office International des Epizooties, 30 (3),

839-870.

Суэйн, Д. Э., Радин, М. Дж., Хёпф, Т. М., и Слемонс, Р. Д. (1994). Острая почечная недостаточность как причина смерти цыплят

после внутривенной инокуляции вирусом птичьего гриппа A / курица / Алабама / 7395/75 (h5N8).Авиан Дис,

38 (1), 151-157.

Такахаши, К., Фурута, Ю., Фукуда, Ю., Куно, М., Камияма, Т., Кодзаки, К., Номура, Н., Эгава, Х., Минами, С., &

Шираки, К. (2003). Активность Т-705 и осельтамивира против вируса гриппа in vitro и in vivo. Antivir Chem

Chemother, 14 (5), 235-241.

Такеда, С., Такешита, М., Кикучи, Ю., Дашням, Б., Кавахара, С., Йошида, Х., Ватанабе, В., Мугурума, М., &

, Курокава, М.(2011). Эффективность перорального приема убитых нагреванием пробиотиков из монгольских молочных продуктов

против инфекции гриппа у мышей: облегчение инфекции гриппа за счет его иммуномодулирующей активности через

кишечного иммунитета. Int Immunopharmacol, 11 (12), 1976-1983 гг.

Тао, З., Ян, Ю., Ши, В., Сюэ, М., Ян, В., Сун, З., Яо, К., Инь, Дж., Ши, Д., Чжан, Ю. ., Цай, Ю., Тонг, К., и Юань, Ю.

(2013). Ожидается, что дополнительная и альтернативная медицина внесет больший вклад в борьбу с распространенностью гриппа

. Biosci Trends, 7 (5), 253-256.

Томас К., Манин Т. Б., Андриясов А. В. и Суэйн Д. Э. (2008). Ограниченная восприимчивость и отсутствие системной инфекции

вирусом свиного гриппа h4N2 у цыплят, инокулированных интраназально. Авиан Дис, 52 (3), 498-501.

Томас, М., Ге, К., Лу, Дж. Дж., Клибанов, А. М., и Чен, Дж. (2005). Опосредованная поликатионом доставка миРНК для профилактики

и лечения инфекции вируса гриппа. Экспертное мнение Biol Ther, 5 (4), 495-505.

Тиан, Г., Чжан, С., Ли, Ю., Бу, З., Лю, П., Чжоу, Дж., Ли, К., Ши, Дж., Ю, К., и Чен, Х. (2005). Защитная эффективность вакцины, инактивированной H5N1, разработанной с помощью обратной генетики, у

кур, гусей и уток. Вирусология, 341 (1), 153-162.

Толба, М. К., и Эскарус, Дж. К. (1959). Ответ некоторых штаммов вирусов ньюкаслской болезни и птичьей чумы на два хинона

. Арка Микробиол, 34, 325-332.

Томпкинс, С. М., Ло, К. Ю., Тампи, Т. М., и Эпштейн, С. Л. (2004). Защита от заражения летальным вирусом гриппа за счет интерференции

РНК in vivo. Proc Natl Acad Sci U S A, 101 (23), 8682-8686.

Тонг, С., Ли, Ю., Ривайлер, П., Конрарди, К., Кастильо, Д.А., Чен, Л.М., Рекуэнко, С., Эллисон, Дж. А., Дэвис, Коннектикут, Йорк, I.

A ., Турмел, А.С., Моран, Д., Роджерс, С., Ши, М., Тао, Ю., Вейл, М.Р., Тан, К., Роу, Л.А., Саммонс, С., Сюй,

X. , Фрейс, М., Линдблейд, К.А., Кокс, Н. Дж., Андерсон, Л. Дж., Рупрехт, К. Э., и Донис, Р. О. (2012). Отдельная линия

вируса гриппа А от летучих мышей. Слушания Национальной академии наук Соединенных Штатов Америки

Америка, 109 (11), 4269-4274.

Тонг, С., Чжу, X., Ли, Ю., Ши, М., Чжан, Дж., Буржуа, М., Ян, Х., Чен, X., Рекуенко, С., Гомес, Дж. ., Chen, LM,

Johnson, A., Tao, Y., Dreyfus, C., Yu, W., McBride, R., Carney, PJ, Gilbert, A.Т., Чанг, Дж., Го, З., Дэвис, К.

Т., Полсон, Дж. К., Стивенс, Дж., Руппрехт, К.Э., Холмс, Е.К., Уилсон, И.А., и Донис, Р. О (2013) . Новый мир

летучих мышей являются носителями различных вирусов гриппа А. PLoS Pathogens, 9 (10), e1003657.

Тош, К., Муругкар, Х.В., Нагараджан, С., Трипати, С., Катаре, М., Джайн, Р., Хандия, Р., Сайед, З., Бехера, П., Патил, С. ,

Кулкарни, Д. Д. и Дубей, Южная Каролина (2011). Появление в Индии устойчивого к амантадину вируса птичьего гриппа H5N1.

Гены вирусов, 42 (1), 10-15.

Триана-Бальцер, Великобритания, Бабицки, М., Чан, MC, Вонг, AC, Ашенбреннер, Л.М., Кэмпбелл, ER, Ли, QX, Чан, Р.

W., Пейрис, Дж. С., Николлс, Дж. М., И Фанг, Ф. (2010). DAS181, слитый белок с сиалидазой, защищает эпителий дыхательных путей человека

от инфекции вирусом гриппа: фармакодинамический анализ in vitro. J. Antimicrob Chemother, 65 (2),

275-284.

Триана-Бальцер, Г. Б., Губарева, Л. В., Климов, А. И., Вуртман, Д. Ф., Мосс, Р. Б., Хедлунд, М., Ларсон, Дж. Л., Белше, Р.

Б., и Фанг, Ф. (2009). Ингибирование вируса гриппа, устойчивого к ингибиторам нейраминидазы, с помощью DAS181, нового слитого белка сиалидазы

. PLoS One, 4 (11), e7838.

Почему следует прекратить ветеринарное использование противовирусных препаратов в Египте? – Features

Если не будут приняты меры по пресечению злоупотребления противовирусными препаратами некоторыми производителями ветеринарных препаратов, надвигается кризис общественного здравоохранения.

Эль-Сайед Абдельваб и Ислам Хусейн
Противовирусные препараты являются стандартной линией лечения нескольких заболеваний человека, таких как ВИЧ / СПИД, гепатит С, грипп и несколько инфекций, вызванных вирусом герпеса. После десятилетий противовирусных исследований единственным противовирусным соединением, разрешенным для ветеринарного использования в некоторых странах, является иммуномодуляторный рекомбинантный кошачий интерферон.

Безответственное использование амантадина, лекарственного средства против гриппа, в коммерческом птицеводстве в Китае привело к появлению устойчивых к лекарствам мутантов среди смертельных штаммов гриппа, что сделало этот препарат неэффективным для лечения инфекций человека 1 .

Это оставило группу противогриппозных препаратов, известных как ингибиторы нейраминидазы, включая осельтамивир, в качестве последней линии защиты для лечения клинических инфекций гриппа человека. Имеются данные о широко распространенном злоупотреблении амантадином в Египте, единственной стране на Ближнем Востоке, где вирус птичьего гриппа H5N1 является эндемическим 2 .

Генетический анализ выявил доказательства устойчивости к амантадину у 48% штаммов египетских птиц H5N1.

Провал массовой вакцинации и устойчивость к амантадину побудили некоторых местных исследователей в Египте изучить пригодность осельтамивира для домашней птицы 3 .Даже если осельтамивир может быть эффективным во время вспышки H5N1, в свете слабости нормативных требований, связанных с ветеринарными фармацевтическими препаратами, безответственное использование весьма вероятно и, вероятно, приведет к лекарственной устойчивости.

В сочетании с постепенной адаптацией египетских штаммов H5N1 к человеку этот сценарий обернулся бы катастрофой для общественного здравоохранения.

Устойчивость к противовирусным препаратам – серьезная проблема

Природа вирусов делает их склонными к частым случайным мутациям в геномах.В отличие от антибактериальных средств, противовирусные препараты обычно имеют очень узкий спектр и могут атаковать конкретную вирусную мишень. Мутация, затрагивающая эту мишень, может сделать лекарство бесполезным и привести к появлению устойчивых к лекарствам вариантов.

Устойчивые к лекарствам мутанты возникают в результате избирательного давления препарата на группу генетически связанных, но не идентичных вирусов. Некоторые из этих вариантов уже несут в себе мутации, приобретенные естественным путем, которые позволяют им реплицироваться в присутствии препарата.

Устойчивость к лекарствам – обычная клиническая проблема, поэтому схемы противовирусной терапии всегда основывались на комбинациях лекарств; ВИЧ / СПИД – хороший тому пример. Однако преимущества наличия нескольких лекарств недоступны в случае вирусов гриппа, для которых современная терапия основана на одной группе лекарств, нацеленных на белок на внешней поверхности вируса, известный как нейраминидаза (NA). Риск клинической устойчивости к противовирусным препаратам увеличивается в условиях иммуносупрессии, профилактического применения и несоблюдения схем лечения, что приводит к получению субоптимальных доз препарата.

Подобные сценарии также применимы к животным и птицам, что создает проблемы для ветеринарного применения противовирусных препаратов.

Пример Египта

Птицефабрики в Египте практически не регулируются.
Птица является основным источником животного белка в Египте, где на нее приходится около 10% всего сельскохозяйственного производства. Эта отрасль с бюджетом в 2 миллиарда долларов США состоит из коммерческих предприятий с относительно низким уровнем биобезопасности и большого количества домашних птиц, деятельность которых не подлежит регулированию.

Одной из основных проблем, с которыми сталкивается птицеводческий сектор в Египте, является широкий спектр вирусных инфекций, поражающих этих птиц. Среди некоторых других вирусов вирусы гриппа и герпеса возглавляют список патогенов, вызывающих серьезные экономические потери. В частности, вирусы зоонозного гриппа H5N1 представляют серьезную угрозу для здоровья человека. Помимо широко распространенных вспышек среди коммерческих птиц, он стал причиной самого большого числа инфекций среди людей во всем мире.

Другая значительная группа вирусов гриппа, принадлежащих к подтипу H9N2, также совместно циркулирует с вирусами H5N1 и недавно вызвала инфекции у людей.

Многие вирусологи очень внимательно следят за обострением ситуации с гриппом в Египте, потому что, если эти вирусы продолжат мутировать, допустив передачу среди людей, сценарий может привести к новой пандемии гриппа 4 .

Доступные в настоящее время противогриппозные препараты делятся на две основные группы: блокаторы M2 (например, амантадин) и ингибиторы нейраминидазы (например, осельтамивир).

Блокаторы M2 мешают процессу разворачивания вирусного генетического материала внутри клетки при инфицировании; в то время как ингибиторы нейраминидазы блокируют высвобождение вновь образованных вирусных частиц из инфицированных клеток.

Ацикловир, аналог ациклических нуклеозидов, был одним из первых соединений, когда-либо разработанных для лечения инфекций вируса герпеса человека. Он подавляет репликацию герпесвирусной ДНК после метаболизма внутри инфицированных клеток с помощью кодируемого вирусом фермента, известного как тимидинкиназа.

Незаконное использование и устойчивость

Необходимы более строгие правила для контроля за производством египетских ветеринарных фармацевтических препаратов.

Регистрация ветеринарных препаратов, содержащих противовирусные соединения, в Египте не разрешена.По состоянию на ноябрь 2014 г. регистрация всех фармацевтических препаратов, содержащих амантадин, была полностью запрещена из-за их неэффективности при лечении инфекций гриппа человека 5 . Однако, несмотря на эти правила, мы идентифицировали по крайней мере пять коммерческих ветеринарных препаратов, содержащих амантадин, и два других, содержащих ацикловир.

Дальнейшее расследование показало, что эти продукты зарегистрированы в Министерстве сельского хозяйства как пищевые добавки для ветеринарного применения, и, скорее всего, противовирусные препараты могли быть незаконно добавлены во время производства.Мы также обратили внимание на то, что ветеринарное использование дешевых фармацевтических препаратов, первоначально зарегистрированных для людей, не является редкостью, по словам нескольких ветеринаров, которые анонимно беседовали с авторами.

Чтобы оценить влияние использования противогриппозных соединений в ветеринарии, мы проанализировали 250 последовательностей M2 и 481 NA, доступных в базах данных для изолятов птичьего и человеческого H5N1, собранных в Египте в период с 2006 по 2015 год.

Около 48% Птичий и 10% человеческих последовательностей H5N1 M2 обнаруживали генетические маркеры устойчивости к амантадину.Наш анализ также показал, что эти устойчивые мутанты появились в середине 2007 г .; через несколько месяцев после предполагаемого времени применения амантадина для выращиваемой домашней птицы. Кроме того, в недавно опубликованном исследовании сообщалось о маркерах устойчивости к амантадину в трех современных египетских изолятах H9N2 6 . Среди 481 доступной последовательности NA для египетских штаммов H5N1 два вируса птиц и три вируса человека показали маркеры устойчивости к осельтамивиру.

Устойчивость вирусов герпеса животных к антигерпетическим аналогам ациклических нуклеозидов может быстро возникнуть в лаборатории 7 .Однако мы не смогли проанализировать влияние полевого использования ацикловира, поскольку в базах данных была доступна только одна последовательность гена тимидинкиназы, принадлежащая птичьему герпесвирусу.

Требуются более жесткие правила

Несмотря на то, что несколько вирусов проявляют признаки устойчивости 8 , до сих пор инфекции H5N1 человека в Египте успешно лечились с помощью осельтамивира, особенно при введении на ранней стадии инфекции. И все же осельтамивир – относительно дорогое лекарство.Вызывает тревогу тот факт, что в местных исследованиях изучаются способы повышения рентабельности перорального введения осельтамивира домашней птице3.

Все инфекции H5N1 человека с 2009 года вызываются группой вирусов с повышенным сродством к связыванию с типом рецепторов, присутствующих на поверхности клеток человека. Если эти вирусы приобретут устойчивость к осельтамивиру после его широкомасштабного использования у домашней птицы, общественное здоровье окажется под угрозой, поскольку мы потеряем наш краеугольный препарат для лечения людей.

Необходимы более строгие правила контроля за производством египетских ветеринарных фармацевтических препаратов.

Устойчивость к амантадину уже широко распространена, поэтому нет смысла включать ее в какие-либо пищевые добавки, используемые для птицы. Ацикловир не одинаково эффективен против всех вирусов герпеса, и его противовирусная эффективность против этих типов, заражающих домашнюю птицу, не установлена, поэтому его использование у домашней птицы является чисто эмпирическим и ненужным. Группа соединений-ингибиторов нейраминидазы, примером которой является осельтамивир, в настоящее время является нашим единственным активом для лечения пациентов с гриппом у людей.

Следует запретить использование озельтамивира в птицеводстве.

Ислам Хусейн, исследователь и вирусолог Массачусетского технологического института, Массачусетс. В настоящее время он участвует в нескольких проектах, направленных на выявление, отслеживание и исследование любых генетических изменений, которые могут привести к образованию потенциально пандемических штаммов гриппа.

Эль-Сайед Абдельваб – ветеринар и исследователь, специализирующийся на птичьем гриппе. Он базируется в Федеральном научно-исследовательском институте здоровья животных, Германия. Его исследования направлены на понимание молекулярной биологии вирусов птичьего гриппа как предпосылки для развития птицеводства вакцина.

Противовирусная активность лямбда-интерферона у кур

РЕФЕРАТ

Интерфероны (IFN) являются важными компонентами системы противовирусной защиты позвоночных. У млекопитающих функциональные рецепторы IFN типа III (лямбда-интерферон [IFN-λ]) обнаруживаются в основном на эпителиальных клетках, и было продемонстрировано, что IFN-λ играет решающую роль в ограничении вирусных инфекций слизистых оболочек. Чтобы определить, играет ли IFN-λ аналогичную роль у птиц, мы продуцировали рекомбинантный куриный IFN-λ (chIFN-λ) и использовали компетентную в отношении репликации ретровирусную векторную систему RCAS для создания мозаично-трансгенных куриных эмбрионов, которые конститутивно экспрессируют chIFN-λ. Мы смогли продемонстрировать, что chIFN-λ заметно ингибирует репликацию различных штаммов вирусов, включая высокопатогенные вирусы гриппа A, in ovo и in vivo , а также в богатых эпителием тканевых и клеточных культурах. Напротив, куриные фибробласты плохо реагировали на chIFN-λ. При применении in vivo к 3-недельным цыплятам рекомбинантный chIFN-λ сильно индуцировал IFN-чувствительный ген Mx в богатых эпителием органах, таких как легкие, трахеи и кишечные тракты.Соответственно, было обнаружено, что эти органы экспрессируют высокие уровни транскрипта гена предполагаемой альфа-цепи рецептора chIFN-λ (chIL28RA). Трансфекция куриных фибробластов экспрессирующей конструкцией chIL28RA сделала эти клетки чувствительными к обработке chIFN-λ, что указывает на то, что экспрессия рецептора определяет специфичность клеточного типа действия IFN-λ у кур. Удивительно, но мозаично-трансгенные цыплята погибли вскоре после вылупления, демонстрируя пагубный эффект конститутивной экспрессии chIFN-λ.Наши данные подчеркивают фундаментальное сходство между системами IFN-λ млекопитающих и птиц и предполагают, что IFN типа III может играть роль в защите слизистых оболочек от проникновения вирусов у большинства, если не у всех позвоночных.

ВВЕДЕНИЕ

Интерфероны (IFN) играют центральную роль в защите позвоночных от вирусных инфекций (1). Индуцированные вирусом ИФН представляют собой сложную смесь ИФН типа I и типа III. IFN типа I включают альфа-интерферон (IFN-α), IFN-β и различные другие второстепенные виды IFN, которые все передают сигнал через общий рецептор клеточной поверхности, который присутствует в широком диапазоне типов клеток (2, 3).IFN типа III у человека включают IFN-λ1, IFN-λ2 и IFN-λ3 (также называемые интерлейкином-29 [IL-29], IL-28A и IL-28B, соответственно), которые передают сигнал через гетеродимерный рецептор на поверхности клетки, состоящий из IFN-λ-специфической цепи IL28Rα и цепи IL10Rβ (4, 5). У млекопитающих цепь IL28Rα преимущественно экспрессируется эпителиальными клетками (6), тогда как IL10Rβ, по-видимому, экспрессируется повсеместно (7). Следовательно, IFN-λ защищает главным образом эпителиальные клетки респираторного и желудочно-кишечного тракта от вирусных инфекций (8, 9).Распознавание лиганда рецепторами IFN I или III типа приводит к быстрой активации пути JAK-STAT, что, в свою очередь, приводит к фосфорилированию STAT1 и STAT2 и к образованию активного транскрипционного IFN-стимулированного гена фактора 3 (ISGF3). Большой объем данных свидетельствует о том, что IFN типа I и типа III активируют практически идентичные наборы IFN-стимулированных генов (ISG), которые кодируют противовирусные белки, такие как Mx или 2 ‘, 5’-олигоаденилатсинтетаза (OAS) (10–12). .

Курица (Gallus gallus) использовалась в качестве прототипа для исследования системы IFN птиц.Идентифицированы несколько генов IFN-α, а также отдельные IFN-β, IFN-ω, IFN-τ и IFN-κ, представляющие систему IFN куриного типа I (13, 14). Было показано, что введение куриного IFN-α (chIFN-α) значительно замедляет индуцированное вирусом саркомы Рауса образование опухоли, что свидетельствует о его противовирусных свойствах in vivo (15). Другое исследование продемонстрировало, что лечение chIFN-α улучшает прогрессирование заболевания после экспериментального заражения цыплят штаммом H5N1 высокопатогенного вируса гриппа A (HPAIV) (16).

В дополнение к IFN типа I был описан единственный ген куриного IFN-λ (chIFN-λ), и было показано, что его продукт запускает умеренный противовирусный ответ в клеточной линии макрофагов курицы HD11 и в первичных куриных эмбриональных клетках. фибробласты (CEF) (17). Более недавний отчет показал, что стимуляция CEF рекомбинантным chIFN-λ индуцирует ISG по временному паттерну, отличному от такового для IFN типа I (18). Однако на сегодняшний день неизвестно, вносит ли IFN-λ вклад в противовирусную защиту инфицированных птиц.

Для решения этой проблемы in vitro , in ovo и in vivo , мы использовали рекомбинантный chIFN-λ и использовали компетентную в отношении репликации систему вектора переноса ретровирусных генов RCAS (19, 20) для получения цыплят. эмбрионы, сверхэкспрессирующие chIFN-λ. Мы наблюдали ответы ISG преимущественно в богатых эпителием органах, которые сильно экспрессируют транскрипты IL28RA. У птиц, получавших chIFN-λ, репликация высокопатогенного вируса гриппа задерживалась, демонстрируя, что этот цитокин играет решающую роль в устойчивости хозяина.

МАТЕРИАЛЫ И МЕТОДЫ

Вирусы. В данном исследовании использовались штаммы вируса гриппа A: A / WSN / 1933 h2N1 (WSN), A / Chicken / United Arab Emirates / R66 / 2002 H9N2 (R66), A / FPV / Rostock / 34 H7N1 (FPV Rostock) и рекомбинантный A / swan / Germany / R65 / 2006 H5N1 (rR65-wt). Кроме того, рекомбинантный вирус, несущий сегменты генома HA, NP, NA, M и NS птичьего штамма R65 и сегменты PB1, PB2 и PA штамма млекопитающих A / Puerto Rico / 8/1934 h2N1 (PR8), обозначенный rR65-PR8 (123), использовался (16).Кроме того, использовали штамм вируса велогенной болезни Ньюкасла (NDV) Herts-33 и штамм вируса инфекционного бронхита (IBV) Massachusetts 41 (M41; любезно предоставлены C. Winter, Ганновер, Германия). Штаммы вируса везикулярного стоматита (VSV), использованные в этом исследовании, представляли собой штамм Indiana и штамм VSV, экспрессирующий зеленый флуоресцентный белок (VSV-GFP) (21).

Запасы вируса получали в куриных яйцах с эмбрионами или культурах клеток собачьей почки Madin-Darby (MDCK). Титры вирусов штаммов гриппа, NDV и VSV определяли путем иммуноокрашивания субстратом TrueBlue (KPL, Gaithersburg, MD, USA) на клетках MDCK, как описано ранее (16), и выражали в виде фокусообразующих единиц (FFU).Титры M41 IBV определяли как средние инфекционные дозы клеточной культуры (CID 50 ) на первичных клетках почек куриного эмбриона.

Культуры клеток и органов. Куриные фибробласты DF-1 культивировали в среде Игла, модифицированной Дульбекко (DMEM; с добавлением 10% фетальной телячьей сыворотки [FCS], пенициллин-стрептомицина [Pen / Strep] и l-глутамина) при 37 ° C и при необходимости разделите. Клетки CLEC-213 куриных легких (любезно предоставленные П. Кере [22]) культивировали в DMEM-F12 (с добавлением 10% FCS, Pen / Strep, l-глутамина и инсулина-трансферрина-селен-X [Gibco]). при 37 ° С.Культуры трахеальных органов собирали из куриных эмбрионов на 19-й эмбриональный день (ED19), как описано ранее (16). Кольца культивировали индивидуально с 0,6 мл среды Хэнкса 199 (с добавлением 0,2% бычьего сывороточного альбумина, Pen / Strep и l-глутамина) в 5-мл пробирках при 37 ° C, вращающихся в подвесном шейкере. Активность ресничек контролировали через 48 часов после подготовки, и для дальнейших экспериментов были выбраны кольца трахеи со 100% активностью ресничек.

Вирусные векторы, экспрессирующие chIFN-α или chIFN-λ для создания мозаично-трансгенных цыплят.Кодирующая последовательность chIFN-α была амплифицирована с плазмиды pcDNA1 – chIFN-α1 (14). кДНК для chIFN-λ получали из РНК инфицированных вирусом первичных CEF с помощью обратной транскрипции (RT) -PCR с использованием специфических праймеров. В нашей культуре CEF были обнаружены две разные последовательности мРНК chIFN-λ, которые отличались друг от друга одним полиморфизмом глутаминовой кислоты к лизину в положении 150 аминокислоты (номера доступа KF680102 и KF680103). Все описанные здесь эксперименты проводились с вариантом Glu-150 (KF680102).

Последовательности, кодирующие chIFN-α и chIFN-λ, были введены в плазмиду RCASBP (A) (далее называемую RCAS [19]) через сайт рестрикции ClaI, и правильность вставки была проверена путем секвенирования. Клетки DF-1 трансфицировали конструкциями RCAS с использованием нанофектина (Peqlab, Erlangen, Германия), следуя инструкциям производителя. Через 16-24 ч инкубации среду заменяли, и клетки культивировали в течение не менее 10 дней, прежде чем их использовали для исследований вирусной инфекции или для создания мозаично-трансгенных куриных эмбрионов.

Мозаично-трансгенные куриные эмбрионы получали путем инъекции 10 6 RCAS-инфицированных клеток DF-1 в аллантоисную полость яиц (Lohmann Tierzucht GmbH, Куксхафен, Германия) в ED3. Это приводит к инфицированию эмбриональных клеток частицами RCAS, продуцируемыми инъецированными клетками, с последующей интеграцией вирусной ДНК в геном клеток-хозяев. Было показано, что ретровирусные белки и продукты трансгенов обнаруживаются в первую очередь в кровеносных сосудах, сердце и коже мозаично-трансгенных птиц, созданных с использованием векторов RCAS (20).Введенные яйца инкубировали в инкубаторе для яиц и либо подвергали заражению вирусом на ED14, либо собирали для получения культур трахеальных органов на ED19, либо позволяли развиваться до вылупления.

Производство рекомбинантных chIFN-α и chIFN-λ.E. coli производный chIFN-α продуцировали, как описано ранее, и биологическую активность определяли с использованием репортерных клеток CEC-32, экспрессирующих люциферазу светлячка под контролем куриного промотора Mx (23). Для получения рекомбинантного chIFN-λ кодирующую последовательность chIFN-λ амплифицировали из плазмиды RCAS-chIFN-λ и клонировали в pcDNA3.3 (Invitrogen, Карлсбад, Калифорния, США). Клетки HEK 293 трансфицировали pcDNA3.3 – chIFN-λ с использованием нанофектина (Peqlab). После отбора с помощью G418 (500 мкг / мл) были собраны и размножены отдельные клоны клеток. Противовирусную активность chIFN-λ в супернатанте определяли с помощью биоанализа, описанного ниже. Для получения высококонцентрированных исходных материалов chIFN-λ выбранный клеточный клон выдерживали в течение 3 дней в Opti-MEM, содержащем 0,2% бычий сывороточный альбумин (БСА), прежде чем супернатант был собран, очищен от клеточного мусора низкоскоростным центрифугированием и сконцентрирован. с использованием колонок Centricon 70 (100 кДа; Millipore, Billerica, MA, USA).Аликвоты концентрированного супернатанта хранили при -80 ° C. Титры chIFN-λ определяли с использованием биоанализа VSV-GFP, как описано ниже.

Получение клеток DF-1, стабильно экспрессирующих chIL28RA. Для получения предполагаемой последовательности альфа-цепи рецептора chIFN-λ (chIL28RA) суммарную РНК экстрагировали из легких курицы VALO White Leghorn (Lohmann Tierzucht GmbH) перед проведением RT. выполняли с использованием Revertaid (Fermentas, Schwerte, Германия) и олиго (dT). ПЦР выполняли с использованием полимеразы Phusion (Fermentas) и праймеров chIL28RA-F (5′-AGCCTTTGAATTTAAACTTTTTATCA-3 ‘) и chIL28RA-R (5′-TTCAGCATGTCTGCATGGAGAA-3’).Очищенный в геле продукт ПЦР клонировали в вектор pcDNA3.3 (Invitrogen), и полученную плазмиду использовали для трансфекции клеток DF-1. После отбора G418 (500 мкг / мл) индивидуальные клоны отбирали по сильным ответам на обработку chIFN-λ с использованием анализа VSV-GFP. Все описанные здесь эксперименты были выполнены с клоном 23 DF-1 – chIL28RA.

Биотест VSV-GFP. ChIFN-λ-индуцированная защита от инфекции VSV-GFP (21) была использована для скрининга клонов chIFN-λ-чувствительных клеток, как и а также для титрования препаратов рекомбинантного chIFN-λ.Вкратце, клетки, посеянные в 96-луночные планшеты, обрабатывали в течение ночи серийными разведениями препаратов IFN, разведенных в Opti-MEM с 0,2% BSA. Впоследствии клетки инфицировали VSV-GFP при множественности инфицирования (MOI) 0,5. Через 24 часа после заражения (p.i.) флуоресценцию количественно оценивали с использованием планшет-ридера Infinite M200 (Tecan, Crailsheim, Германия), и интенсивность сигналов корректировали путем вычитания фоновой флуоресценции неинфицированных контрольных лунок. Результаты выражали как процент противовирусной активности, который определяли как процент снижения скорректированной интенсивности сигнала по сравнению с необработанными контрольными лунками, инфицированными VSV-GFP.Титры chIFN-λ определяли на клетках клона 23 DF-1 – chIL28RA, и одна единица была определена как значение концентрации 50% ингибирования, рассчитанное с помощью нелинейной аппроксимации кривой с помощью программного обеспечения GraphPad Prism (GraphPad Software, La Jolla, CA, USA).

Анализ qRT-PCR. Для количественного анализа RT-PCR (qRT-PCR) образцы органов или мазки из глотки замораживали в Trifast (Peqlab) при -70 ° C сразу после отбора образцов. Гомогенаты органов центрифугировали при 6000 × g в течение 30 минут при 4 ° C и собирали супернатанты. Затем образцы обрабатывали через колонки Direct-zol 96 (Zymo, Фрайбург, Германия) и обрабатывали ДНКазой (Fermentas). RT выполняли с использованием Revertaid (Fermentas) с олиго (dT) (для измерения мРНК chMx и chIL28RA) или случайных гексамеров (для измерения вирусной РНК) с 1 мкг обработанной ДНКазой РНК в конечном объеме 20 мкл. Один микролитр продукта ОТ использовали для анализа количественной ПЦР с использованием набора Sensifast SybrHi-Rox (Bioline, Luckenwalde, Германия) в соответствии с инструкциями производителя. Праймеры для обнаружения вируса гриппа A были получены от Fouchier et al.(24), а праймеры для амплификации мРНК chMx были получены от Schusser et al. (25). Праймеры qPCRmbRA-F (5′-GAAGCCGGATCTGAAGACAA-3 ‘) и qPCRmbRA-R (5′-TGATATCTTAACACATCCTTCCTCAG-3′) использовали для обнаружения мРНК chIL28RA. Транскрипты куриного β-актина амплифицировали с использованием праймеров chBActin-F (5’-CACAGATCATGTTTGAGACCTT-3 ‘) и chBActin-R (5′-CATCACAATACCAGTGGTACG-3’). Результаты qRT-PCR рассчитывали как отношения chMx- или chIL28RA к актину по методу 2 Δ CT .

Лечение IFN и экспериментальное заражение цыплят вирусом гриппа А.Оплодотворенные куриные яйца белого леггорна, не содержащие специфических патогенов, были приобретены у Lohmann Tierzucht GmbH и позволили им вылупиться. Птенцов выращивали в помещении Фрайбургского университета. Для измерения индукции in vivo IFN-стимулированных генов трехнедельных цыплят обрабатывали либо 5 × 10 6 единиц рекомбинантного chIFN-λ, полученного из стабильно трансфицированных клеток HEK 293 ( n = 4 птицы). , 2 × 10 6 единиц chIFN-α, полученного из Escherichia coli ( n = 4), или фосфатно-солевого буфера (PBS) ( n = 3) путем комбинированного внутривенного введения (i.v.) и окулоназально (o.n.) дважды с 6-часовым интервалом. Через два часа после второй обработки всех животных умерщвляли и собирали образцы органов для измерения уровней мРНК chMx и chIL28RA с помощью qRT-PCR.

Во втором эксперименте три группы по семь цыплят в каждой аналогичным образом обрабатывали либо 2 × 10 6 , либо 1 × 10 6 единиц chIFN-λ, полученного из HEK 293, или PBS. Через 2 часа после второй обработки все птицы были инфицированы окулоназально 10 6 FFU штамма вируса гриппа A rR65-PR8 (123) H5N1 на птицу, как описано ранее (16).После этого лечение повторяли ежедневно с той же дозой. Так как птицы были помещены в изолятор после заражения и поскольку в / в. в этих условиях инъекции были невозможны, лечение проводилось комбинированным внутримышечным (в / м) и внутримышечным введением. заявление. Мазки из глотки собирали ежедневно для определения вирусной РНК с помощью qRT-PCR. Птицы наблюдались на предмет наличия симптомов два раза в день, и клинические признаки регистрировались в виде клинических баллов 0 (отсутствие клинических признаков), 1 (легкие клинические признаки), 2 (тяжелые клинические признаки) или 3 (мертвые), как описано ранее ( 16).На 5 день p.i. всех животных умерщвляли и собирали образцы мозга для титрования вирусной нагрузки. Эксперимент по заражению проводился в изоляторе в условиях 3-го уровня биобезопасности.

Все эксперименты на животных проводились в соответствии с немецким законом о защите животных (TierSchG). Животные содержались и содержались в соответствии с надлежащей практикой в ​​отношении животных, как определено FELASA (www.felasa.eu/recommendations) и национальным органом защиты животных GV-SOLAS (www.gv-solas.де /). Все эксперименты на животных были одобрены местными комитетами по защите животных.

Статистический анализ. Уровни вирусной РНК и мРНК и вирусные титры были log 10 трансформированы для статистического анализа. Парные сравнения группы, получавшей IFN, с группой, не получавшей лечения, проводили с помощью теста Стьюдента t . Множественные сравнения более чем двух групп были выполнены с помощью одностороннего дисперсионного анализа (ANOVA) и последующего сравнения средних значений Тьюки. Кривые выживаемости сравнивались с помощью критерия логарифмического ранга (Мантел-Кокса), а критерий суммы рангов Вилкоксона использовался для сравнения клинических показателей двух разных групп.Все тесты проводились с использованием призмы GraphPad (программа GraphPad). P Значения <0,05 считались указанием на значимые различия между группами.

Номера доступа нуклеотидных последовательностей. Последовательности мРНК chIFN-λ и chIL28RA, полученные в ходе этого исследования, были представлены в GenBank под номерами доступа от KF680102 до KF680105.

РЕЗУЛЬТАТЫ

Слабая противовирусная активность chIFN-λ в линии клеток фибробластов DF-1. Для оценки противовирусной активности chIFN-λ мы сконструировали ретровирусный вектор, способный к репликации, который конститутивно экспрессирует кДНК chIFN-λ (RCAS – chIFN- λ).Трансфекция фибробластов куриного DF-1 этой конструкцией привела к быстрому распространению вируса и стабильной экспрессии chIFN-λ (данные не показаны). Примерно через 2 недели после трансфекции клетки инфицировали либо VSV, штаммом вируса гриппа A WSN (h2N1), либо FPV Rostock (H7N1) при множественности инфекции (MOI) 0,001. Культуры клеток, постоянно инфицированные пустым вектором (RCAS-Ø) или вектором, несущим ген chIFN-α (RCAS – chIFN-α), служили в качестве отрицательного и положительного контроля соответственно.chIFN-α почти полностью блокировал VSV и WSN и сильно снижал титры FPV Rostock. Напротив, chIFN-λ оказывал только очень слабое ингибирующее действие на эти вирусы (рис. 1), что согласуется с предыдущими наблюдениями других групп (17).

FIG. 1

Клетки DF-1, трансгенно экспрессирующие chIFN-λ, не приобретают значительной устойчивости к вирусу. Клетки DF-1, постоянно инфицированные пустым вектором RCAS (RCAS-Ø), RCAS, экспрессирующие chIFN-λ (RCAS – chIFN-λ), или RCAS, экспрессирующие chIFN-α (RCAS – chIFN-α), инфицировали указанными контрольными вирусами при MOI равняется 0.001, и титры вирусов в супернатантах определяли в указанные моменты времени. Результаты представлены как средние значения логарифмически преобразованных вирусных титров (± стандартная ошибка среднего [SEM]) из 2 или 3 независимых экспериментов. Начало оси y указывает предел обнаружения титрования.

Эмбриональные куриные яйца, трансгенно экспрессирующие chIFN-λ, обладают высокой степенью устойчивости к вирусу. Для оценки биологических свойств chIFN-λ in ovo мы создали мозаично-трансгенные куриные эмбрионы путем инокуляции оплодотворенных яиц RCAS – chIFN-λ или RCAS-Ø на ED3.Генерация мозаично-трансгенных эмбрионов chIFN-α не была успешной из-за того, что вектор RCAS – chIFN-α был нестабильным в этих условиях (неопубликованные данные). На ED14 эмбрионы заражали инокуляцией различных вирусов гриппа A, NDV Herts-33 или IBV M-41 через аллантоисную полость. Для всех проанализированных вирусных штаммов средние титры в аллантоисных жидкостях от chIFN-λ-трансгенных эмбрионов через 24 или 36 ч p.i. были уменьшены по крайней мере на четыре log 10 единиц по сравнению с таковыми у пустых векторно-трансгенных эмбрионов (рис.2). Кроме того, выживаемость chIFN-λ-трансгенных куриных эмбрионов, инфицированных штаммом rR65-wt (H5N1), была значительно увеличена ( P <0,05; фиг. 3), что ясно демонстрирует противовирусную активность chIFN-λ.

FIG 2

Эмбрионированные куриные яйца, трансгенно экспрессирующие chIFN-λ, проявляют высокую степень устойчивости к вирусу. Мозаично-трансгенные эмбрионы получали путем инфицирования яиц пустым вектором RCAS (RCAS-Ø) или RCAS, экспрессирующим chIFN-λ (RCAS – chIFN-λ) на ED3. В ED14 проводили эксперименты по заражению вирусом путем инокуляции 10 2 FFU на яйцо [R66, rR65-wt, rR65-PR8 (123)] или 10 3 FFU на яйцо (WSN, Herts-33, M41) в аллантоисная полость.Аллантоисные жидкости собирали через 24 часа [rR65-wt, rR65-PR8 (123), Herts-33] или 36 часов (R66, WSN, M41) после заражения. Символы указывают титры вирусов в отдельных яйцах. Начало оси y указывает предел обнаружения титрования.

Рис. 3.

Гибель эмбрионов, вызванная вирусом гриппа, задерживается за счет RCAS-опосредованной экспрессии chIFN-λ. Мозаично-трансгенные эмбрионы, полученные путем инфицирования указанными векторами RCAS в ED3, инокулировали 10 2 FFU на яйцо штамма вируса гриппа A rR65-wt (H5N1) в ED14.Выживаемость эмбриона контролировали путем просвечивания яиц в указанные моменты времени. Статистический анализ выявил значительную разницу между двумя группами ( P <0,05; логарифмический ранговый тест).

chIFN-λ подавляет размножение вируса гриппа в культурах эмбриональных трахеальных органов. Поскольку известно, что IFN-λ млекопитающих действует преимущественно на эпителиальные клетки, мы затем исследовали защитный эффект chIFN-λ на культурах трахеальных органов. Кольца трахеи, происходящие из chIFN-λ-трансгенных или пустых вектор-трансгенных куриных эмбрионов, инфицировали штаммами гриппа A rR65-wt или WSN.Титры вирусов в кольцах от chIFN-λ-трансгенных эмбрионов были заметно снижены (рис. 4).

Рис. 4

Снижение роста вируса гриппа в трахее, эксплантированной из мозаично-трансгенных эмбрионов, экспрессирующих chIFN-λ. Культуры трахеальных органов получали на ED19 из эмбрионов, которые были сделаны трансгенными с использованием пустого вектора RCAS (RCAS-Ø) или вектора RCAS, экспрессирующего chIFN-λ (RCAS – chIFN-λ). Жизненно важные кольца трахеи инфицировали штаммами вируса гриппа A rR65-wt (10 2 FFU на кольцо) или WSN (10 3 FFU на кольцо).Вирусные нагрузки в супернатантах представлены как средние значения логарифмически трансформированных вирусных титров (± SEM) семи колец трахеи, происходящих из семи отдельных яиц. Начало оси y указывает предел обнаружения титрования.

Конститутивная экспрессия chIFN-λ является летальной для только что вылупившихся цыплят. Для исследования противовирусной активности chIFN-λ in vivo мозаично-трансгенным эмбрионам давали вылупиться. Хотя пагубного влияния экспрессии chIFN-λ на эмбриональное развитие не наблюдалось (данные не показаны), скорость вылупления RCAS-chIFN-λ-трансгенных яиц была немного снижена по сравнению с таковыми из пустых яиц с трансгенными векторами в двух независимых экспериментах (рис.5А). После вылупления цыплята, экспрессирующие chIFN-λ, были менее активны, чем контрольные животные (данные не показаны), теряли, а не прибавляли в массе тела (рис. 5C), и умирали или были подвергнуты эвтаназии в течение первых 2 недель жизни (рис. 5B). ). Вскрытие трупов цыплят, умерщвленных на 4-й день после вылупления, показало заметно более высокие объемы остаточных желточных мешков у цыплят, трансгенных по chIFN-λ (фиг. 5D), чем у контрольных животных, что указывает на менее эффективное всасывание желтка. Других заметных макроскопических поражений не наблюдалось.

FIG 5

RCAS-опосредованная экспрессия chIFN-λ имеет летальные последствия для кур. Эмбрионам, трансгенным с помощью пустого вектора RCAS (RCAS-Ø) или RCAS, экспрессирующего chIFN-λ (RCAS – chIFN-λ) на ED3, давали возможность вылупиться. (A) Средняя скорость вылупления (± SEM) из двух независимых экспериментов. (B) Выживание мозаично-трансгенных цыплят, несущих либо RCAS-Ø, либо RCAS-chIFN-λ. (C) Средняя масса тела в группе (± SEM) в указанные сроки после вылупления ( n = 8). (D) Вес остаточного желточного мешка цыплят, умерщвленных на 4-й день после вылупления (те же животные, что и на панели C).Звездочки указывают на значительные различия с группой RCAS-Ø (тест Стьюдента t , P <0,05).

Противовирусная активность chIFN-λ зависит от присутствия chIL28RA. Противовирусная активность IFN-λ млекопитающих зависит от экспрессии его родственного рецептора на клетках-мишенях и, точнее, его альфа-субъединицы, IL28RA, экспрессия которой ограничена главным образом ткани, богатые эпителием (6). Мы предположили, что ограниченная экспрессия IL28RA может объяснять отсутствие чувствительности chIFN-λ в клетках DF-1.Последовательности, присутствующие в GenBank, предсказывают растворимый белок для chIL28RA (FJ947119; 26), который, по-видимому, маловероятен в передаче сигналов из-за отсутствия внутриклеточного домена, а также предполагаемого мембраносвязанного chIL28RA (FJ947118; XM_417841; XM_004947908). При выполнении ОТ-ПЦР с РНК из легких курицы мы обнаружили транскрипты, кодирующие предсказанную растворимую изоформу (KF680105; данные не показаны), а также предполагаемый мембраносвязанный белок, состоящий из 567 аминокислот, который включает потенциальный сигнальный пептид и трансмембранные области. (KF680104; рис.6А). Связанный с мембраной белок демонстрирует существенную гомологию с IL28RA мыши и человека и содержит остатки тирозина, соответствующие Tyr-343 и Tyr-517 в IL28RA человека (фиг. 6A), которые, как было показано, имеют решающее значение для чувствительности к IFN-λ (11).

Рис. 6.

Клетки DF-1, экспрессирующие кДНК, кодирующую предполагаемый chIL28RA, реагируют на chIFN-λ и приобретают устойчивость к вирусу. (A) Аминокислотные последовательности предполагаемого куриного IL28RA (номер доступа в GenBank KF680104), человеческого IL28RA (NP_734464) и мышиного IL28RA (AAH57856) выравнивали с использованием программного обеспечения MEGA6 с последующей ручной модификацией.Консервированные позиции заштрихованы серым цветом. Сигнальные пептиды (предсказанные сигналом P) показаны жирным шрифтом, а предсказанные трансмембранные области (предсказанные сервером TMHMM 2.0) представлены в прямоугольниках. Стрелки указывают на консервативные остатки тирозина, которые, как было показано, имеют решающее значение для передачи сигналов человеческого белка (11). (B) Родительские клетки DF-1, клетки DF-1, стабильно трансфицированные экспрессирующей конструкцией chIL28RA, и клетки CLEC-213 куриных легких обрабатывали в течение ночи различными разведениями рекомбинантного chIFN-α или chIFN-λ перед инфицированием VSV-GFP при MOI равняется 0.5. Концентрация неразбавленного препарата chIFN-α составляла 2 × 10 5 единиц / мл (что соответствует 10 4 единиц на лунку). Флуоресценцию измеряли через 24 часа после заражения. Результаты представлены как средняя противовирусная активность (± SEM) из двух независимых экспериментов.

Чтобы продемонстрировать, что предполагаемый chIL28RA придает чувствительность к chIFN-λ, мы трансфицировали клетки DF-1 плазмидой, кодирующей chIL28RA, и отбирали для постоянно трансфицированных клонов клеток. Такие клоны и родительские клетки DF-1 затем обрабатывали серийными разведениями рекомбинантного chIFN-λ, контрольной среды или chIFN-α перед контрольным заражением VSV-GFP.Обработка chIFN-λ индуцировала хорошую защиту в клетках, трансфицированных chIL28RA, но не в родительских клетках DF-1 (фиг. 6B). В соответствии с этим, qRT-PCR выявила 1400-кратное повышение уровней транскрипта chIL28RA в стабильно трансфицированных клетках DF-1 (данные не показаны). Эти результаты подтвердили функциональность нашей последовательности chIL28RA и позволили нам использовать вновь созданную линию клеток для количественного определения рекомбинантных препаратов chIFN-λ in vitro . Интересно, что стабильная клеточная линия CLEC-213, которая была получена из эпителиальных клеток легких курицы (22), имела 4-кратное повышение уровней транскрипта chIL28RA по сравнению с уровнями нетрансфицированных клеток DF-1 (данные не показаны), а также реагировала на чИФН-λ.Однако для индукции противовирусной активности в клетках CLEC-213 требовались более высокие концентрации цитокинов, чем в клетках DF-1, трансфицированных chIL28RA (фиг. 6B).

Экспрессия

chIL28RA в органах коррелирует с транскрипцией гена Mx в ответ на обработку цыплят chIFN-λ. Группы из трех-четырех трехнедельных цыплят обрабатывали либо 5 × 10 6 единиц рекомбинантного chIFN-λ, полученного из стабильно трансфицированные клетки HEK 293, 2 × 10 6 единиц chIFN-α, полученного из E.coli, или PBS путем объединения i.v. и o.n. нанесение дважды с интервалом в 6 часов. Через два часа после второй обработки все животные были умерщвлены и собраны образцы органов. Транскрипцию chIL28RA и стимулированного IFN гена chMx определяли с помощью qRT-PCR. Уровни транскрипции chIL28RA были самыми низкими в головном мозге, в то время как никаких заметных различий между другими протестированными органами не наблюдалось. Обработка IFN не приводила к заметной активации транскрипции гена IL28RA (фиг. 7A). Напротив, транскрипция гена chMx значительно индуцировалась во всех органах после обработки птиц либо chIFN-λ, либо chIFN-α (рис.7Б). В богатых эпителием органах, таких как кишечник, легкие, трахея и почки, chMx в большей степени индуцировался chIFN-λ, чем chIFN-α, тогда как в мозге, печени и сердце ответ на chIFN-α был доминирующим ( Рис. 7Б).

ФИГ. 7 Обработка

chIFN-λ индуцирует транскрипцию гена chMx in vivo . Трехнедельных цыплят обрабатывали дважды с интервалом в 6 ч 5 × 10 6 единиц рекомбинантного chIFN-λ или 2 × 10 6 единиц рекомбинантного chIFN-α путем комбинированного внутримышечного и окулоназального введения.Птицы, обработанные PBS, использовали в качестве контроля. Через два часа после второй обработки птиц умерщвляли и определяли уровни мРНК генов chIL28RA (A) и chMx (B) с помощью qRT-PCR. Различные строчные буквы в одном органе указывают на значительные различия между группами лечения (односторонний дисперсионный анализ с последующим сравнением средних значений по Тьюки, P <0,05).

Обработка цыплят рекомбинантным chIFN-λ обеспечивает частичную защиту от заражения высокопатогенным вирусом гриппа A H5N1.Группы из семи птиц дважды обрабатывали либо высокой, либо низкой дозой (2 × 10 6 или 1 × 10 6 единиц) chIFN-λ, как описано выше. Через 2 часа после второй обработки всех птиц инокулировали 10 6 FFU штамма вируса гриппа A rR65-PR8 (123) H5N1 на птицу окулоназальным путем. После инфицирования лечение IFN повторялось ежедневно путем комбинированного внутримышечного и окулоназального введения. Было продемонстрировано, что контрольный вирус rR65-PR8 (123) вызывает тяжелое клиническое заболевание у цыплят, но был чувствителен к лечению E.coli производный chIFN-α (16). В представленном здесь эксперименте у инфицированных цыплят развивались клинические признаки от легкой до тяжелой, начиная со 2-го дня после инфицирования, без значительных различий между группами, получавшими IFN, и контрольной группой ( P > 0,05; фиг. 8A). Выделение вирусной РНК количественно оценивали с помощью анализа qRT-PCR мазков из глотки. Через 1-3 дня после инфицирования вирусная нагрузка значительно снизилась в группе, получавшей 2 × 10 6 единиц chIFN-λ, по сравнению с таковой в группе, получавшей PBS ( P <0.05), тогда как обработка 10 6 единиц chIFN-λ имела лишь умеренные эффекты (фиг. 8B). В конце эксперимента уровни вирусной РНК в мазках из глотки были одинаковыми во всех трех группах. Титры вирусов в образцах головного мозга, собранных на 5-й день после инфицирования, были значительно снижены примерно на 1 log 10 единиц ( P <0,05) в группе, получавшей 2 × 10 6 единиц chIFN-λ по сравнению с таковыми из PBS. -обработанная группа (фиг. 8C). Эти данные демонстрируют, что обработка in vivo высокими дозами рекомбинантного chIFN-λ обеспечивает частичную защиту от экспериментальной инфекции высокопатогенным вирусом гриппа А.

Рис. 8.

Обработка трехнедельных цыплят очищенным chIFN-λ частично защищает от заражения вирусом H5N1 rR65-PR8 (123). Цыплят ежедневно обрабатывали указанными дозами chIFN-λ, причем первую дозу вводили за 8 ч до заражения вирусом. Заражение 10 6 FFU rR65-PR8 (123) на птицу осуществлялось окулоназальным путем. (A) Клинический осмотр проводился два раза в день, и симптомы оценивались в зависимости от степени тяжести. (B) Вирусные нагрузки в мазках из глотки определяли количественно с помощью qRT-PCR.Результаты представлены как среднее значение логарифмически преобразованных значений (± SEM; n = 7). (C) Цыплят умерщвляли на 5-й день после инфицирования и определяли титры вирусов в головном мозге. Начало осей y указывает предел обнаружения теста. Звездочки указывают на значительные различия с контрольной группой, не получавшей лечения (тест Стьюдента t ; P <0,05).

ОБСУЖДЕНИЕ

Здесь мы сообщаем, что chIFN-λ обладает противовирусной активностью у кур. Наши результаты показывают, что подобно IFN-λ млекопитающих, chIFN-λ действует преимущественно на эпителиальные ткани.Фактически, куриные фибробласты в значительной степени невосприимчивы к противовирусному действию chIFN-λ, что согласуется с ранее опубликованными работами (17, 18). Напротив, chIFN-λ ингибировал репликацию вирусов гриппа в культурах первичных эмбриональных трахеальных органов и в линии клеток легких курицы CLEC-213, хотя противовирусная активность chIFN-λ была менее выраженной, чем у chIFN-α в этих системах. В соответствии с этими результатами, лечение chIFN-λ in vivo привело к сильной индукции стимулированного интерфероном гена Mx в богатых эпителием тканях, таких как кишечник, трахея и легкие, в то время как в органах с меньшим содержанием эпителиальных клеток, ответ на chIFN-α был доминирующим.Чувствительность к chIFN-λ коррелировала с уровнями транскрипта куриного гомолога IL28RA, который кодирует лиганд-связывающую молекулу в функциональном рецепторном комплексе IFN-λ млекопитающих (4). Кроме того, эктопическая экспрессия chIL28RA делает клетки DF-1 очень чувствительными к chIFN-λ. Таким образом, система IFN-λ птиц, по-видимому, напоминает систему IFN-λ млекопитающих в отношении неоднородной экспрессии цепи IL28Rα, что выражается в высокой степени специфичности клеточного типа ответа IFN-λ (6).

Наши попытки трансгенно сверхэкспрессировать chIFN-λ дали убедительные доказательства того, что этот цитокин обладает противовирусной активностью также in ovo . Эксперименты с эмбриональными яйцами показали, что вирусные титры широкого спектра вирусов были заметно снижены у мозаично-трансгенных эмбрионов chIFN-λ, инфицированных через аллантоисную полость. Кроме того, эксперименты с контрольным заражением высокопатогенным вирусом гриппа A продемонстрировали, что трансгенные эмбрионы частично защищены от гибели, вызванной вирусом.Эти данные предполагают, что chIFN-λ, продуцируемый трансгенным эмбрионом, способен запускать рецептор IFN-λ эпителиальных клеток в хориоаллантоисной мембране. Однако наша работа также показала, что chIFN-λ может иметь пагубные последствия. Наши попытки получить мозаично-трансгенных цыплят chIFN-λ не увенчались успехом, поскольку такие птицы погибали в течение первых 2 недель после вылупления. Единственными крупными повреждениями, наблюдаемыми у цыплят, умерщвленных в возрасте 4 дней, были неадсорбированные желточные мешки. Желток является источником питания для эмбриона, он поглощается и переваривается эпителием желточного мешка во время эмбриогенеза и после вылупления.При развитии после вылупления желток может дополнительно транспортироваться в кишечник через стебель и поглощаться кишечным эпителием после переваривания кишечными ферментами (27, 28). Таким образом, объем желточного мешка со временем уменьшается. Поскольку пагубные эффекты у цыплят, трансгенных по chIFN-λ, по-видимому, возникают во время или вскоре после вылупления, есть соблазн предположить, что конститутивная экспрессия chIFN-λ препятствует одному из последних процессов по неизвестному механизму. Альтернативное объяснение может заключаться в том, что chIFN-λ нарушает формирование нормальной кишечной флоры и тем самым препятствует всасыванию питательных веществ после вылупления.Интересно отметить, что ежедневная инъекция высококонцентрированных препаратов интерферона была смертельной для новорожденных мышей, причем смертность наступала через 7–14 дней лечения (29).

Дополнительное доказательство того, что chIFN-λ играет роль в противовирусной защите цыплят, было получено в экспериментах, в которых трехнедельных цыплят лечили рекомбинантным chIFN-λ до и во время инфицирования высокопатогенным вирусом гриппа A H5N1. Предыдущая работа продемонстрировала, что многие полевые изоляты H5N1 чрезвычайно агрессивны для цыплят и что высокая вирулентность таких вирусов не может быть уменьшена путем обработки птиц chIFN-α (16).Однако реассортантный вирус H5N1 rR65-PR8 (123), который несет гены полимеразы вируса гриппа человека, растет у цыплят значительно медленнее, чем родительский вирус rR65-wt, и не может вызывать заболевание, если птиц лечить chIFN-α ( 16). В нашем текущем исследовании мы использовали этот реассортантный вирус для оценки защитного потенциала рекомбинантного chIFN-λ. Мы обнаружили, что лечение chIFN-λ не очень эффективно для предотвращения заболевания, вызванного rR65-PR8 (123), но высокие дозы (2 × 10 6 единиц на птицу и лечение) цитокина явно замедляли выведение вируса через верхние дыхательные пути. тракт и привел к снижению распространения вируса в мозг.Мы предполагаем, что дальнейшее увеличение дозировки могло привести к более выраженному противовирусному эффекту. Однако недостаточно концентрированных препаратов chIFN-λ, чтобы оспорить эту гипотезу, не было. Наблюдения на мышах показали, что IFN типа I вносит наибольший вклад в защитный противовирусный ответ на инфекции вируса гриппа A, тогда как IFN-λ играет лишь незначительную роль в легких (8, 30). Мы предполагаем, что в дыхательных путях кур не все клетки слизистой оболочки чувствительны к chIFN-λ.Таким образом, лечение может только отсрочить, но не полностью предотвратить прохождение высокопатогенным вирусом птичьего гриппа эпителиального барьера и достижение типов клеток в других органах, которые не реагируют на IFN-λ. Эта точка зрения согласуется с результатами исследования крупного рогатого скота, в котором опосредованная аденовирусом сверхэкспрессия бычьего IFN-λ может резко снизить и задержать репликацию вируса и экспрессию вируса ящура, вируса, первичным местом репликации которого является верхние дыхательные пути. тракт.Интересно, что противовирусный эффект был менее выраженным, когда эпителиальный барьер преодолевался при внутрислизистой инъекции вируса, по сравнению с интраназальной аэрозольной инокуляцией (31). Более поздняя работа с модельной системой мышей показала, что IFN-λ имеет центральное значение для контроля ротавирусов мышей, которые в первую очередь инфицируют эпителиальные клетки кишечника (9). В будущих исследованиях будет очень интересно определить, справедливо ли то же самое для цыплят и может ли IFN-λ, как предсказывалось в исследованиях на мышах, также контролировать репликацию желудочно-кишечных вирусов с сильным эпителиотропизмом, таких как ротавирусы, у птиц.

БЛАГОДАРНОСТИ

Этот проект финансировался Федеральным министерством образования и исследований Германии (BMBF) как часть FluResarchNet.

Мы благодарим Annette Ohnemus за отличную техническую помощь, Pascale Quéré за предоставление клеток CLEC-213 и Christine Winter за предоставление штамма IBV M41.

Мы заявляем об отсутствии финансовых или личных отношений с другими людьми или организациями, которые могли бы ненадлежащим образом повлиять на нашу работу.

СНОСКИ

    • Поступила 23 сентября 2013 г.
    • Принято 5 декабря 2013 г.
    • Принято рукопись размещена в Интернете 26 декабря 2013 г.
  • Авторские права © 2014, Американское общество микробиологии. Все права защищены.

Границы | Противовирусная активность куриного кателицидина B1 в отношении вируса гриппа A

Введение

Кателицидины – короткие катионные пептиды, играющие важную роль во врожденном иммунном ответе против инфекций. Они в основном экспрессируются лейкоцитами и эпителиальными клетками в местах инфицирования хозяина.Кателицидины были обнаружены у всех позвоночных, включая свиней, собак, человека и курицу, но с некоторым разнообразием по количеству и структуре. Например, у человека присутствует только один кателицидин длиной 37 аминокислот (LL-37), в то время как курица имеет четыре кателицидина (CATH-1, -2, -3 и -B1) различной длины. Кателицидины обладают прямым антимикробным действием против широкого круга бактерий, а также обладают многими иммуномодулирующими функциями в отношении клеток-хозяев (Cuperus et al., 2013; van Harten et al., 2018). Из кателицидинов кур наиболее изучен CATH-2.Помимо того, что он обладает широкой антибактериальной активностью, он может ингибировать LPS-индуцированную активацию TLR4 и усиливать ДНК-индуцированную активацию TLR21 в макрофагах (Coorens et al., 2015; Coorens et al., 2017). Кроме того, было описано, что обработка CATH-2 in ovo снижает смертность, вызванную птичьим патогенным вирусом E. coli у кур (Cuperus et al., 2016). О других кателицидинах кур известно меньше. CATH-1 и CATH-3, по-видимому, разделяют, по крайней мере, антимикробную активность и их локализацию с CATH-2 (Veldhuizen et al., 2013; Секелова и др., 2017). Напротив, функция CATH-B1 практически не изучена, но он отличается от CATh2-3 своей локализацией в сумке Fabricius у кур (Goitsuka et al., 2007). Кроме того, до сих пор неизвестна противовирусная активность всех куриных кателицидинов.

Вирус гриппа A (IAV) – важный патоген для человека и животных. Инфекция IAV вызывает острые респираторные заболевания, приводящие к заболеваемости и смертности людей и многих видов животных. За последние 100 лет вирусы гриппа A, такие как h2N1 в 1918 году и h4N2 в 1968 году, вызвали серьезные пандемии у людей (Cox and Subbarao, 2000; Webby and Webster, 2003).IAV животных, такие как высокопатогенный IAV H5N1, представляют постоянную угрозу возникновения новой пандемии. Сообщается, что этот последний вирус заражает людей со смертностью 52,8% в период с 2003 по 2019 год (источник: ВОЗ). Более того, из-за быстрой геномной изменчивости IAV появляются новые варианты (такие как H7N9 в 2013 г.), которые представляют новую угрозу для здоровья человека (Khazeni et al., 2014). В настоящее время вакцинация и препараты против IAV используются для профилактики и лечения инфекций IAV. Однако эффективность вакцинации частично ограничена из-за антигенной изменчивости, в то время как использование препаратов против IAV ограничивается развитием устойчивости.Следовательно, необходимы новые профилактические и терапевтические возможности против инфекции IAV.

В этом исследовании мы исследовали противовирусную активность и механизм действия куриных кателицидинов против IAV. Результаты нашего исследования предоставляют полезную информацию для разработки методов лечения инфекции IAV.

Материалы и методы

Пептиды

Все пептиды были синтезированы компанией China Peptides (Шанхай, Китай) с использованием Fmoc-химии. Все пептиды очищали с помощью высокоэффективной жидкостной хроматографии с обращенной фазой до чистоты> 95%.

Клеточные линии и вирусы

Клетки

HD11 (линия куриных макрофагов) и клетки почек Madin – Darby Canine (MDCK-II; ATCC) культивировали в RPMI 1640-glutaMAX и DMEM-glutaMAX (Gibco, Великобритания), соответственно, с добавлением 10% FCS и антибиотики (100 Ед / мл пенициллина и 100 мкг / мл стрептомицина).

Вирус гриппа A / Puerto Rico / 8/34 / Mount Sinai (h2N1 / PR8) и реассортантные вирусы размножали в клетках MDCK-II, как описано ранее, и хранили аликвотами при -80 ° C до использования.Генерация реассортантных вирусов h4N1 (содержащих ген HA из A / Bilthoven / 1761/76 (h4N2) в генетическом фоне PR8) и H5N1 (содержащих ген HA из A / duck / Hunan / 795/2002 (H5N1) в генетический фон PR8) был описан ранее (Koel et al., 2013; Peeters et al., 2017). Вирус h4N1 любезно предоставил Рон Фушье (Медицинский центр Эразмус, Нидерланды). Титры вирусов определяли для клеток MDCK-II путем расчета 50% инфекционной дозы культуры ткани на мл (TCID50 / мл), как описано ранее (Reed and Muench, 1938).

Вирусная инфекция

Клетки

MDCK-II и HD11, засеянные в 96-луночные планшеты и выращенные до конфлюэнтности, инфицировали вирусом при множественности инфицирования (MOI) 0,1 в присутствии или в отсутствие кателицидинов в течение 1 ч при 37 ° C. В исследованиях предварительной инкубации CATH добавляли к клеткам на 1 час, смывали PBS, после чего добавляли IAV на 1 час. Постинкубационные исследования выполняли аналогично, но с обратным порядком добавления пептида и вируса. Все этапы начальной инфекции и инкубации кателицидина выполнялись в отсутствие сыворотки.После этих инкубаций несвязанный вирус или несвязанный пептид удаляли путем двукратной промывки клеток PBS (с добавлением Ca 2+ и Mg 2+ ). Клетки MDCK-II и HD11 инкубировали в течение еще 7 часов с opti-MEM или RPMI 1640-glutaMAX с добавлением 2% FCS, соответственно, при 37 ° C. Затем клетки фиксировали холодным метанолом при -20 ° C в течение 5 минут, после чего клетки окрашивали первичным мышиным моноклональным антителом HB65 (1: 1000), специфичным к нуклеопротеину, и меченными Alexa Fluor 488 ослиными антителами против мышиного IgG ( Life technologies, Юджин, штат Орегон, США) (1: 1000), как описано ранее (De Vries et al., 2011). Клетки визуализировали с использованием ядерного красителя DAPI (Thermo Fischer Scientific) в соответствии с инструкциями производителя. С помощью микроскопа EVOS FL (Thermo Fisher Scientific) делали по три изображения на лунку и подсчитывали инфицированные клетки. Число инфицированных клеток в засеянных лунках с имитационной обработкой было установлено на уровне 100%.

Чтобы выяснить, присутствует ли прямое взаимодействие CATH-B1 с вирусом и, возможно, требуется ли оно для активности CATH-B1, были использованы гранулы Capto Core 700 (GE Healthcare) для удаления CATH-B1, который не был связан с вирусом.Для этого вирусы предварительно инкубировали в среде opti-MEM с CATH-B1 или без него в течение 30 минут при 37 ° C, после чего к образцам добавляли шарики Capto Core 700 и образцы инкубировали в течение 20 минут при 4 ° C. при вращении. После этого шарики центрифугировали и собирали супернатанты. Чтобы контролировать эффективное удаление CATH-B1, образцы, содержащие CATH-B1, но не содержащие вируса, подвергали той же процедуре. Клетки инокулировали супернатантами (или их комбинациями) и обрабатывали для определения количества инфицированных клеток, как описано выше.

Жизнеспособность клеток

Жизнеспособность клеток

определяли с помощью анализа WST-1 в соответствии с протоколом производителя. Короче говоря, клетки инкубировали с пептидами в течение 1 часа при 37 ° C, затем пептиды смывали и клетки дополнительно инкубировали в течение 7 или 23 часов при 37 ° C (что соответствует времени инкубации, используемому для иммуногистохимии и обнаружения цитокинов. экспрессия генов соответственно). Среду для культивирования клеток удаляли и заменяли свежей культуральной средой, содержащей 10% реагента WST-1.После 20 мин инкубации оптическую плотность измеряли при 450 нм с помощью микропланшетного ридера FLUOstar Omega и корректировали на оптическую плотность при 630 нм.

Электронная микроскопия

Вирус гриппа A (h4N1) инкубировали в присутствии или в отсутствие CATH-B1 в течение 1 ч при 37 ° C и 10 мкл образца помещали на покрытую углеродом медную сетку. Сетки трижды промывали PBS и фиксировали 1% глутаровым альдегидом (Sigma-Aldrich) в PBS в течение 10 мин. Затем сетки дважды промывали PBS и четыре раза MilliQ.Затем сетки быстро промывали метилцеллюлозой / уранилацетатом (pH 4) и инкубировали в течение 5 минут с метилцеллюлозой / уранилацетатом (pH 4) на льду. Наконец, сетки были извлечены из раствора и высушены на воздухе. Образцы получали на электронном микроскопе Tecnai-12 (FEI).

Анализ MUNANA и ELLA

Активность NA в присутствии CATH-B1 по отношению к синтетическому одновалентному субстрату 2 ‘- (4-метилумбеллиферил) -альфа-DN-ацетилнейраминовая кислота (MUNANA) (Sigma-Aldrich) была определена с помощью флуорометрического анализа аналогично тому, что было описано ранее (Dai et al., 2017). Короче говоря, IAV инкубировали с CATH-B1 (0–40 мкМ) в течение 1 часа при 37 ° C с последующим добавлением MUNANA еще в течение 1 часа при 37 ° C. Затем реакцию останавливали и измеряли интенсивность флуоресценции с помощью считывающего устройства для микропланшетов FLUOstar Omega. Активность NA в отношении сиалированного гликопротеина фетуина анализировали в твердофазном анализе расщепления с использованием ранее описанного анализа ферментативно-связанного лектина (ELLA) (Dai et al., 2017; Du et al., 2019). Фетуин (2,5 мкг / мл) наносили на 96-луночные планшеты Maxisorp Nunc (Thermo Fisher Scientific).Планшеты инкубировали с IAV PR8 (1,78 × 10 8 БОЕ / мл) в присутствии или в отсутствие 5 мкМ CATH-B1 (в 50 мМ трис-HCl с 4 мМ CaCl 2 , pH = 6) в течение 2 часов. при 37 ° С. Затем планшеты трижды промывали PBS / 0,05% Tween 20, после чего количественно определяли концевые остатки галактозы, используя конъюгированный с биотином арахисовый агглютинин E. Cristagalli (ECA), лектин (Vector Laboratories) (1,5 мкг / мл) в сочетании со стрептавидином. HRP (Thermo Fisher Scientific) (1: 1000). После отмывки добавляли TMB и инкубировали планшеты в течение 1–4 мин при комнатной температуре.Сульфидную кислоту (25%) использовали для остановки реакции. Наконец, планшет считывали при OD450 нм с использованием считывающего устройства для микропланшетов FLUOstar Omega. Конечные значения OD450 нм представлены как OD450 нм образец -OD450 нм задний фон .

Количественная ПЦР в реальном времени (кПЦР)

клеток HD11 инфицировали вирусом в течение 1 часа при множественности инфицирования (MOI), равной 1, в присутствии или в отсутствие CATH-B1, как описано выше. После 8 или 24 ч инкубации суммарную РНК экстрагировали реагентом Trizol (Ambion, Карлсбад, Калифорния, США) в соответствии с инструкциями производителя.РНК (500 нг) подвергали обратной транскрипции с помощью набора для синтеза кДНК iScript (Bio-Rad, Veenendaal, Нидерланды) в соответствии с инструкциями производителя. Праймеры и зонды были разработаны и произведены Eurogentec (Seraing, Бельгия) (Таблица 1). Количественную ПЦР в реальном времени проводили на приборе для количественной ПЦР CFX Connect с CFX Manager 3.0 (Bio-Rad). Реакции проводили следующим образом: 3 мин при 95 ° C; 40 циклов: 10 с при 95 ° C, 30 с при 60 ° C и 30 с при 72 ° C. Уровни относительной экспрессии генов были нормализованы относительно уровней экспрессии гена домашнего хозяйства GAPDH.

Таблица 1. Последовательности праймеров и зондов для КПЦР.

Статистический анализ

Данные представлены как среднее ± SEM трех независимых экспериментов для каждой группы ( n = 3) и были проанализированы с помощью теста T для двух групп или одностороннего дисперсионного анализа с тестом множественных сравнений Тьюки для более чем двух. группы. Программное обеспечение Bio-Rad CFX Manager 3.0 использовалось для анализа данных количественной ПЦР. Все графики были построены с помощью GraphPad Prism 5.0.

Результаты

Цитотоксичность и активность кателицидинов против IAV

Для изучения анти-IAV активности кателицидинов в этом исследовании были использованы три штамма IAV (h2N1 / PR8, h4N1 и H5N1).Клетки HD11 и MDCK инокулировали IAV в присутствии или в отсутствие 5 мкМ кателицидинов в течение 1 часа. Через 1 час вирусы и пептиды удаляли, а клетки инкубировали еще 7 часов. Через 8 часов после инфицирования (hpi) количество инфицированных клеток определяли с помощью иммунофлуоресцентного мечения ядерного белка гриппа. Как показано на рисунке 1, кателицидины проявляли различную противовирусную активность, которая для некоторых из них в некоторой степени зависела от штамма вируса и используемой линии клеток.PMAP-23 и K9 существенно не подавляли инфекцию. Интересно, что LL-37 проявлял активность только против h4N1 и в меньшей степени против h2N1, но не против H5N1, тогда как куриные кателицидины были активны против всех трех штаммов гриппа с подавлением инфекционности на 40–70%. Однако, независимо от используемой клеточной линии или штамма вируса, CATH-B1 явно проявлял самую сильную противовирусную активность, подавляя инфекцию до 80–90%.

Рисунок 1. Противовирусный эффект кателицидинов против 3 штаммов IAV (h2N1 / PR8, h4N1 и H5N1).Кателицидины смешивали со штаммами вирусов перед добавлением к клеткам HD11 или MDCK. Инфекция h2N1 / PR8 в присутствии кателицидинов клеток HD11 (A) или MDCK (B) . h4N1 в присутствии кателицидинов клеток HD11 (C) или MDCK (D) . Инфекция H5N1 в присутствии кателицидинов клеток HD11 (E) и MDCK (F) . Вирусную инфекцию определяли с помощью иммунофлуоресцентного обнаружения ядерного белка IAV.Были сделаны три изображения на лунку и подсчитаны инфицированные клетки. Уровень инфицирования в присутствии кателицидинов был нормализован только для лунок, обработанных вирусом. Данные представлены как среднее значение ± стандартная ошибка среднего трех независимых экспериментов с тремя повторностями образцов за эксперимент. * p ≤ 0,05; ** p ≤ 0,01; *** p ≤ 0,005; **** p ≤ 0,001.

Ингибирующая инфекционность CATH-B1 была дозозависимой (рис. 2) с почти полным подавлением вирусной инфекционности штаммов h2N1 и h4N1, в то время как ингибирование H5N1 достигало 85% (рис. 2).Наблюдаемое снижение количества инфицированных клеток не было связано с токсичностью кателицидинов по отношению к клеточным линиям млекопитающих, как показывает анализ WST (рис. 3). Тем не менее, цитотоксичность наблюдалась для CATH-1 и CATH-3 в концентрации 10 мкМ по отношению к клеткам HD11 (рис. 3A).

Рисунок 2. Дозозависимая противовирусная активность CATH-B1 против штаммов IAV (h2N1 / PR8, h4N1 и H5N1). (A) Вирусная инфекция в присутствии CATH-B1 в клетках HD11, (B) Вирусная инфекция в присутствии CATH-B1 в клетках MDCK.Вирусную инфекцию определяли с помощью иммунофлуоресцентного обнаружения ядерного белка IAV. Были сделаны три изображения на лунку и подсчитаны инфицированные клетки. Скорость инфицирования в присутствии кателицидинов нормализовали по отношению к вирусам только в контрольных лунках. Данные представлены как среднее значение ± стандартная ошибка среднего для двух независимых экспериментов с тремя повторностями образцов за эксперимент. * p ≤ 0,05; ** p ≤ 0,01; *** p ≤ 0,005; **** p ≤ 0,001.

Рисунок 3. Цитотоксичность кателицидинов. Клетки HD11 и MDCK инкубировали с кателицидинами, и метаболическую активность тестировали с помощью WST-реагента. (A) Метаболическая активность клеток HD11, инкубированных в течение 24 часов с кателицидинами. (B) Метаболическая активность клеток MDCK, инкубированных в течение 8 часов с кателицидинами. Данные представлены как среднее значение ± стандартная ошибка среднего трех независимых экспериментов с тремя повторностями образцов за эксперимент. * p ≤ 0,05; ** p ≤ 0,01.

Когда кателицидины и вирус были последовательно добавлены к клеткам (либо до, либо после инкубации пептида по сравнению с инокуляцией вируса), ингибирующий эффект в основном терялся (дополнительный рисунок S1).Это указывает на то, что противовирусный эффект пептидов не был достигнут за счет взаимодействия с клетками HD11 или MDCK или за счет ингибирующего действия на репликацию вирусов после того, как вирусы проникли в клетки, но что CATH-B1, вероятно, блокировал проникновение вируса в клетки путем прямого взаимодействия. с вирусом.

Влияние CATH-B1 на индуцированную IAV экспрессию цитокинов в клетках HD11

Активация макрофагов важна для выведения вируса во время инфекции IAV, но чрезмерная воспалительная реакция может вызвать заболеваемость и смертность (Cheung et al., 2002; Ким и др., 2008; Högner et al., 2013). Поскольку сообщалось, что несколько кателицидинов влияют на врожденные иммунные ответы (Coorens et al., 2015; Coorens et al., 2017), мы проанализировали, в какой степени присутствие CATH-B1 влияет на эти ответы, вызванные инфицированием клеток IAV. С этой целью индуцированную вирусом экспрессию генов цитокинов в макрофагах HD11 определяли с помощью кПЦР в присутствии или в отсутствие CATH-B1.

Вирусная инфекция привела к индуцированной экспрессии генов IFN-β, IL-1β, IL-6 и IL-8, но неожиданно не IFN-α.Однако вопрос о том, было ли это отсутствие экспрессии гена IFN-α специфическим для штамма IAV, не исследовался. CATH-B1 подавлял PR8-индуцированную экспрессию генов IFN-β, IL-1β, IL-6 и IL-8, но относительный уровень мРНК IFN-α не влиял (фигура 4A и дополнительная фигура S2). CATH-2 и LL-37 также показали сходные эффекты на экспрессию генов при вирусной инфекции, но ингибирование не было таким выраженным, как наблюдаемое для CATH-B1, что коррелирует с эффектом пептидов на вирусную инфекцию, показанную на Фигуре 1.Влияние CATH-B1 на вирус-индуцированную экспрессию гена уменьшалось, когда клетки инкубировали с CATH-B1 до или сразу после вирусной инфекции (фиг. 4B), что указывает на то, что снижение ответа является результатом способности пептида для подавления инфекции.

Рисунок 4. Влияние CATH-B1 на PR8-индуцированный иммунный ответ в клетках HD11. (A) Экспрессия цитокинов в клетках HD11 через 24 часа на дюйм в присутствии или в отсутствие пептидов. (B) Экспрессия цитокинов в клетках HD11 для пре- или постинкубации с CATH-B1.Уровни относительной экспрессии генов были нормализованы относительно уровней экспрессии гена домашнего хозяйства GAPDH. Данные представлены как среднее значение ± стандартная ошибка среднего для двух или трех независимых экспериментов с тремя повторностями образцов за эксперимент. * P ≤ 0,05; ** P ≤ 0,01; *** P ≤ 0,005; **** P ≤ 0,001.

Взаимодействие CATH-B1 с IAV

Ингибирующее действие CATH-B1 на вирусную инфекцию и индукцию цитокиновых ответов наблюдается только тогда, когда пептид присутствует во время инокуляции клеток вирусом, но не тогда, когда клетки подвергаются воздействию пептидов до или сразу после вирусной инфекции.Это говорит о том, что для его противовирусного эффекта необходимо прямое взаимодействие пептида с вирусом. Для дальнейшего изучения противовирусного механизма CATH-B1 была проведена серия экспериментов с использованием h2N1. Во-первых, решающая роль прямого взаимодействия CATH-B1 с вирусными частицами была проанализирована путем удаления несвязанного CATH-B1 с использованием гранул Capto Core 700. В качестве контроля инкубация самого вируса с шариками не влияла на инфекционность вируса (рис. 5, красная полоса), в то время как добавление раствора CATH-B1 к вирусным препаратам снова приводило к снижению инфекционности вируса на клетках HD11 на 80% (рис. 5, темное поле). зеленая полоса).Инкубация CATH-B1 с гранулами перед добавлением вируса привела к очень слабому противовирусному эффекту (фиг. 5, оранжевая полоса), что указывает на то, что CATH-B1 эффективно удалялся из раствора гранулами. Однако, когда CATH-B1 и вирус были смешаны перед их обработкой гранулами Capto Core 700, противовирусная активность CATH-B1 сохранялась, указывая на то, что CATH-B1 напрямую связан с вирусом и не захватывается гранулами (светло-зеленая полоса , Рисунок 5). Предполагаемое связывание CATH-B1 с вирусом происходит почти мгновенно, потому что в отсутствие 30-минутного времени инкубации при смешивании вируса и CATH-B1 перед добавлением гранул наблюдалась аналогичная противовирусная активность CATH-B1 (данные не показано).Аналогичные результаты были получены с использованием клеток MDCK (дополнительная фигура S3).

Фигура 5. Связывание CATH-B1 с вирусом PR8. CATH-B1 предварительно инкубировали с вирусом h2N1, после чего пептид и вирус разделяли с использованием гранул Capto. Затем (содержащий вирус) супернатант использовали для заражения клеток HD11. Вирусную инфекцию определяли с помощью иммунофлуоресцентного обнаружения ядерного белка IAV. Были сделаны три изображения на лунку и подсчитаны инфицированные клетки. Скорость инфицирования в присутствии CATH-B1 была нормализована относительно контрольных лунок, содержащих только вирус.Данные представлены как среднее значение ± стандартная ошибка среднего трех независимых экспериментов с тремя повторностями образцов за эксперимент. * p ≤ 0,05; ** p ≤ 0,01; *** p ≤ 0,005; **** p ≤ 0,001.

Влияние CATH-B1 на морфологию вируса

Было показано, что некоторые защитные пептиды хозяина, такие как дефенсины нейтрофилов человека, вызывают агрегацию вирусов, которая может способствовать их противовирусной активности (Hartshorn et al., 2006; Doss et al., 2009). Было обнаружено, что другие пептиды, такие как LL-37, напрямую разрушают вирусную мембрану (Tripathi et al., 2013). Чтобы изучить влияние CATH-B1 на морфологию вируса, в этом исследовании в качестве примера был использован h4N1. Как показано на рисунке 6, нет явного изменения вирусной структуры при инкубации с 20 мкМ CATH-B1 (рисунок 6B), CATH-2 (рисунок 6C) или LL-37 (рисунок 6D), однако большие агрегаты были наблюдали, что содержали вирусные частицы и электронно-плотный материал при высокой концентрации (20 мкМ) CATH-B1 (рис. 6E), в то время как некоторые более мелкие агрегаты наблюдались при этой концентрации для CATH-2 и LL-37 (рис. 6F, G).При 5 мкМ CATH-B1 наблюдались более мелкие агрегаты (фиг. 6H), но не для двух других пептидов (фиг. 6I, J). Эти результаты показывают, что связывание и агрегация вирусных частиц, вероятно, участвует в противовирусном механизме CATH-B1.

Рисунок 6. Влияние CATH-B1 на морфологию вируса. Репрезентативные электронные микроскопические изображения (A) h4N1 IAV отдельно (B – G) IAV, предварительно обработанного 20 мкМ и (H – J) 5 мкМ пептидов.Показаны репрезентативные изображения при увеличении 60 000x (A – D), для визуализации морфологии отдельных вирусных частиц или при увеличении 16 500 x (E – J) для визуализации агрегации вирусных частиц. Большие агрегаты пептидов (черные стрелки), содержащие вирусы, и мелкие агрегаты (пунктирные стрелки) были видны при высокой и низкой концентрации пептидов, соответственно.

Влияние CATH-B1 на активность гемагглютинина и нейраминидазы

Гемагглютинин (HA) и нейраминидаза (NA) являются важными функциональными белками на поверхности IAV.Во время вирусной инфекции функция HA заключается в связывании с рецепторами сиаловой кислоты на клетках-хозяевах и последующем слиянии мембран, в то время как для высвобождения вновь собранных вирусных частиц требуется сиалидазная активность NA. Во-первых, мы проанализировали способность CATH-B1 вмешиваться в рецептор-связывающие свойства HA, выполнив анализ ингибирования гемагглютинации. К сожалению, CATH-B1 в некоторой степени индуцировал лизис эритроцитов, что препятствовало дальнейшему анализу анализа ингибирования гемагглютинации.Затем мы проанализировали способность CATH-B1 вмешиваться в активность NA с использованием субстрата MUNANA. Очевидно, что даже при самых высоких концентрациях CATH-B1 не наблюдалось подавления активности NA (фигура 7A). Затем мы выполнили анализ твердофазного расщепления (ELLA) с использованием гликопротеина фетуина. Расщепление фетуина NA в этом анализе зависит от активности NA, но также и от активности HA, поскольку связывание рецептора HA вносит значительный вклад в расщепление NA (Guo et al., 2018; Lai et al., 2019), по крайней мере, когда используются поливалентные рецепторы.CATH-B1 ингибировал расщепление сиаловых кислот на фетуине (фиг. 7B). Поскольку CATH-B1 не влиял на активность NA per se , как продемонстрировано с помощью анализа MUNANA, мы заключаем, что ингибирующий эффект в анализе ELLA является результатом способности CATH-B1 препятствовать связыванию вируса с рецептором.

Рисунок 7. Влияние CATH-B1 на активность НА и NA. (A) NA-активность h2N1 / PR8 измеряли непосредственно с использованием субстрата MUNANA в присутствии или в отсутствие CATH-B1. (B) Десиалилированные N-гликаны фетуина были обнаружены с использованием конъюгированных с HRP лектинов ECA после инкубации с h2N1 / PR8 в присутствии или в отсутствие CATH-B1. Данные представлены как среднее значение ± стандартная ошибка среднего для двух независимых экспериментов с тремя повторностями образцов за эксперимент. * p ≤ 0,05; ** p ≤ 0,01.

Обсуждение

Кателицидины – важные пептиды врожденной иммунной системы, которые защищают от вторжения патогенов. Хотя кателицидины в основном изучались в отношении их антибактериальной активности, в последнее время исследования показывают потенциальную противовирусную активность этих пептидов.Например, было обнаружено, что кателицидин человека LL-37 обладает противовирусной активностью против IAV, аденовируса, респираторно-синцитиального вируса и ВИЧ (Bergman et al., 2007; Barlow et al., 2011; Currie et al., 2016). Кроме того, было обнаружено, что дефенсины, включая α- и β-дефенсины, проявляют противовирусную активность против IAV (Doss et al., 2009).

Куриные кателицидины были изучены достаточно широко, и было показано, что они обладают множеством различных активностей. Помимо антибактериальной активности широкого спектра, они усиливают фагоцитоз, нейтрализуют LPS-индуцированные иммунные ответы и усиливают ДНК-индуцированную активацию TLR21 (Veldhuizen et al., 2013; Coorens et al., 2015; Coorens et al., 2017). Однако противовирусная активность куриных кателицидинов никогда не описывалась. Поэтому мы исследовали активность против IAV и механизм ингибирования кателицидинов кур, поскольку IAV является важным патогеном, вызывающим заболевание у кур, а также у людей.

Четыре куриных кателицидина (CATH-1, -2, -3, -B1) были использованы в этом исследовании вместе с кателицидином свиньи (PMAP-23), собачьим (K9CATH) и человеческим кателицидином (LL-37) для сравнения. Наши результаты показали, что CATH-B1 обладает самой сильной анти-IAV активностью против всех трех протестированных штаммов вирусов в этом исследовании.Сравнение пептидов не дает четкого указания на то, какова может быть основная детерминанта противовирусной активности. Все пептиды имеют (предсказанную) спиральную структуру, являются высококатионными и амфипатическими. Однако сама гомология последовательностей между пептидами довольно низкая (за исключением CATH-1 и CATH-3, которые, по-видимому, также обладают сопоставимой активностью). CATH-B1 немного длиннее, чем другие протестированные кателицидины, но неясно, способствует ли это противовирусной активности. Только для LL-37 были проведены некоторые исследования структуры и противовирусной активности, которые показали, что центральный 20-аминокислотный фрагмент LL-37 играет решающую роль в ингибировании инфекции IAV (Tripathi et al., 2015). Будущие мутационные исследования CATH-B1 могут указать, какие домены или остатки важны для его наблюдаемой активности против IAV.

CATH-B1 отличается от трех других куриных кателицидинов по нескольким параметрам. Сообщается, что помимо некоторых структурных различий и различий в последовательности (таблица 2), он присутствует исключительно в сумке Фабрициуса. Пептид экспрессируется секреторными эпителиальными клетками, но располагается после секреции, окружая Бурсальные М-клетки (Goitsuka et al., 2007).Напротив, CATH-1, -2 и -3 в основном экспрессируются в костном мозге, и, по крайней мере, для CATH-2 было показано, что он присутствует в определенных гранулах в гетерофилах (Van Dijk et al., 2009; Sekelova et al. al., 2017), где пептид высвобождается при заражении (Van Dijk et al., 2009). Чтобы определить, насколько важен CATH-B1 in vivo, против вирусных инфекций, необходимы более подробные исследования его экспрессии и локализации. Если CATH-B1 действительно присутствует только в бурсе, то можно предположить лишь ограниченную противовирусную роль против, например, вируса инфекционной бурсальной болезни, но не против IAV или других репираторных или кишечных вирусов.Однако экспрессия гена CATH-B1, по-видимому, не ограничивается сумкой Фабрициуса. Хотя мРНК CATH-B1 была гораздо ниже, чем в бурсе, она присутствовала в нескольких тканях, включая селезенку и несколько сегментов дыхательного и желудочно-кишечного тракта курицы (Achanta et al., 2012; Rodriguez-Lecompte et al., 2016 ). Экспрессия гена CATH-B1 также наблюдалась в куриных макрофагах HD11 и первичных моноцитах (Sunkara, 2011). Наконец, в некоторых исследованиях описана индуцированная экспрессия генов при стимуляции LPS и LTA in vitro , что указывает на возможность получения более высоких уровней CATH-B1 во многих тканях при вирусной инфекции.

Таблица 2. Характеристики пептидов, использованных в этом исследовании.

Пептиды нейтрофилов человека как противовирусные терапевтические средства вызывают интерес в связи с растущими знаниями об их противовирусном потенциале. Однако противовирусный механизм действия может сильно отличаться от одного HDP к другому, а также зависит от вирусов. Было обнаружено, что человеческий кателицидин LL-37 напрямую взаимодействует с вирионом IAV, тем самым ограничивая репликацию вируса и вызванное вирусом воспаление in vivo (Barlow et al., 2011). In vitro , LL-37, как было описано, непосредственно индуцирует разрушение вирусной мембраны IAV (Tripathi et al., 2013), хотя мы не наблюдали этого в нашем текущем исследовании, что, возможно, связано с различиями в используемых вирусных штаммах. Было показано, что пептиды нейтрофилов человека (HNP) вызывают агрегацию вирусов и ингибируют инфекционность, главным образом, за счет прямого взаимодействия с вирусом без какого-либо ингибирования активности HA IAV (Hartshorn et al., 2006). Другая группа HDP, дефенсины, также продемонстрировала противовирусную активность против IAV и ВИЧ-1, но в основном за счет иммуномодулирующих эффектов во время вирусной инфекции (Wang et al., 2004; Райан и др., 2011). Текущее исследование показало, что CATH-B1 связывается с вирусными частицами, но это не сопровождалось каким-либо очевидным разрушением вирусной мембраны. Вместо этого пептид-вирусные агрегаты наблюдались с помощью электронной микроскопии, что указывает на то, что CATH-B1 может задействовать этот механизм агрегации патогенов, чтобы блокировать инфекцию для вирусной инвазии.

Вирусная мембрана IAV характеризуется двумя ключевыми белками на поверхности вируса, гемагглютинином (HA) и нейраминидазой (NA), оба из которых важны для инфекции IAV и потенциально могут быть затронуты связыванием CATH-B1 с вирусная поверхность.HA функционирует как связывающий рецептор и слитый белок, в то время как белок NA участвует в высвобождении (возникающих) вирусных частиц из рецепторов-ловушек или поверхности клетки (Gamblin and Skehel, 2010; Dou et al., 2018). Недавно сообщалось, что на активность NA IAV влияет связывание вируса с рецептором (Guo et al., 2018; Du et al., 2019; Lai et al., 2019). Активность NA изменяется в зависимости от повышенного или пониженного свойства связывания HA-рецептора. Наши результаты предполагают, что CATH-B1 не влияет на активность NA, а скорее ингибирует активность связывания вирус-рецептора, что согласуется с CATH-B1, влияющим только на вирусную инфекцию, когда она присутствует во время инокуляции вируса.Предположительно ингибирующее действие на взаимодействие вирус-рецептор связано с агрегацией вируса, вызванной CATH-B1. Является ли это явление результатом прямого взаимодействия CATH-B1 с HA, еще предстоит установить, и другие или дополнительные противовирусные механизмы, такие как взаимодействие CATH-B1 с вирусной мембраной, должны быть изучены дополнительно. Этот противовирусный механизм CATH-B1, по-видимому, отличается от механизма LL-37. LL-37 связывается с вирусом, но не ингибирует связывание с HA-рецептором и не может ингибировать связывание вируса с клетками и поглощение ими (Tripathi et al., 2013; Tripathi et al., 2015). Более того, ингибирующая активность LL-37 зависит от используемого штамма IAV, что согласуется с нашим наблюдением, что LL-37 проявляет гораздо большую противовирусную активность против h4N1, чем против h2N1 и H5N1. Следует отметить, что CATH-B1 показал широкую противовирусную активность против IAV, несущих различные белки HA.

В заключение, это исследование показало способность CATH-B1 связывать и ингибировать инфекционность IAV, вероятно, путем вмешательства в HA-опосредованное связывание вируса с рецептором и тем самым блокируя проникновение вируса.Эта новая активность важна для понимания роли этого кателицидина in vivo и , но также может иметь важные последствия для будущей разработки новых противовирусных препаратов на основе кателицидинов в целом.

Заявление о доступности данных

Все наборы данных, созданные для этого исследования, включены в статью / дополнительные материалы.

Авторские взносы

LP провела эксперименты и написала рукопись. WD помогала в проведении экспериментов, MB проводила электромагнитные исследования.HH, EV и CH внесли свой вклад в надзор и написали / исправили рукопись.

Финансирование

Эта работа была поддержана личной стипендией Китайского совета по стипендиям (CSC) для LP.

Конфликт интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

Дополнительные материалы

Дополнительные материалы к этой статье можно найти в Интернете по адресу: https: // www.frontiersin.org/articles/10.3389/fmicb.2020.00426/full#supplementary-material

РИСУНОК S1 | Влияние преинкубации или постинкубации кателицидинов на вирусную репликацию штамма h2N1 / PR8. Инфекция PR8 в клетках HD11 (A) или MDCK (B) для предварительной инкубации с кателицидинами. Инфекция PR8 в клетках HD11 (C) или MDCK (D) для постинкубации с кателицидинами. Вирусную инфекцию определяли с помощью иммунофлуоресцентного обнаружения ядерного белка IAV.Были сделаны три изображения на лунку и подсчитаны инфицированные клетки. Уровень инфицирования в присутствии кателицидинов нормализовали относительно контрольных лунок, содержащих только вирус. Данные представлены как среднее значение ± стандартная ошибка среднего для двух независимых экспериментов с тремя повторностями образцов за эксперимент.

РИСУНОК S2 | Влияние CATH-B1 на PR8-индуцированный иммунный ответ в клетках HD11. Экспрессия цитокинов в клетках HD11 при 8 hpi в присутствии или в отсутствие пептидов. Уровни относительной экспрессии генов были нормализованы относительно уровней экспрессии гена домашнего хозяйства GAPDH.Данные представлены как среднее значение ± стандартная ошибка среднего трех независимых экспериментов с тремя повторностями образцов за эксперимент. p ≤ 0,05; ∗∗ p ≤ 0,01; ∗∗∗ p ≤ 0,005; **** p ≤ 0,001.

РИСУНОК S3 | Связывание CATH-B1 с вирусом PR8. CATH-B1 предварительно инкубировали с вирусом h2N1, после чего пептид и вирус разделяли с использованием гранул Capto. Затем (содержащий вирус) супернатант использовали для заражения клеток MDCK.Вирусную инфекцию определяли с помощью иммунофлуоресцентного обнаружения ядерного белка IAV. Были сделаны три изображения на лунку и подсчитаны инфицированные клетки. Уровень инфицирования в присутствии кателицидинов был нормализован только для лунок, обработанных вирусом. Данные представлены как среднее значение ± стандартная ошибка среднего трех независимых экспериментов с тремя повторностями образцов на эксперимент * p ≤ 0,05; ∗∗ p ≤ 0,01; ∗∗∗ p ≤ 0,005; **** p ≤ 0.001.

Список литературы

Ачанта, М., Сункара, Л. Т., Дай, Г., Бомминени, Ю. Р., Цзян, В. и Чжан, Г. (2012). Экспрессия в тканях и регуляция развития антимикробных пептидов кателицидина кур. J. Anim. Sci. Biotechnol. 3:15. DOI: 10.1186 / 2049-1891-3-15

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Барлоу П. Г., Свобода П., Маккеллар А., Нэш А. А., Йорк И. А., Поль Дж. И др. (2011). Противовирусная активность и повышенная защита хозяина от инфекции гриппа, вызванной кателицидином человека LL-37. PLoS One 6: e25333. DOI: 10.1371 / journal.pone.0025333

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Бергман П., Вальтер-Джаллоу Л., Бролиден К., Агерберт Б. и Содерлунд Дж. (2007). Антимикробный пептид LL-37 подавляет репликацию ВИЧ-1. Curr. HIV Res. 5, 410–415. DOI: 10.2174 / 157016207781023947

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Cheung, C., Poon, L., Lau, A., Luk, W., Lau, Y., Shortridge, K., et al. (2002). Индукция провоспалительных цитокинов в макрофагах человека вирусами гриппа A (H5N1): механизм необычной тяжести заболевания человека? Ланцет 360, 1831–1837. DOI: 10.1016 / s0140-6736 (02) 11772-7

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Куренс, М., Шнайдер, В. А., де Гроот, А. М., ван Дейк, А., Мейеринк, М., Уэллс, Дж. М. и др. (2017). Кателицидины ингибируют Escherichia coli -индуцированную активацию tlr2 и tlr4 зависимым от жизнеспособности образом. J. Immunol. 199, 1418–1428. DOI: 10.4049 / jimmunol.1602164

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Куренс, М., ван Дейк, А., Биккер, Ф., Велдхейзен, Э. Дж., И Хаагсман, Х. П. (2015). Важность деградации эндосомального кателицидина для усиления ДНК-индуцированной активации куриных макрофагов. J. Immunol. 195, 3970–3977. DOI: 10.4049 / jimmunol.1501242

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Куперус, Т., ван Дейк, А., Маттейс, М. Г., Велдхёйзен, Э. Дж., и Хаагсман, Х. П. (2016). Защитный эффект обработки in ovo аналогом куриного кателицидина D-CATH-2 против птичьего патогена E. coli . Sci. Отчет 6: 26622. DOI: 10.1038 / srep26622

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Карри С. М., Финдли Э. Г., Макфарлейн А. Дж., Фитч П. М., Бёттчер Б., Колегрейв Н. и др. (2016). Кателицидины обладают прямой противовирусной активностью против респираторно-синцитиального вируса in vitro и защитной функцией in vivo у мышей и людей. J. Immunol. 196, 2699–2710. DOI: 10.4049 / jimmunol.1502478

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Дай, М., Макбрайд, Р., Дортманс, Дж. К., Пенг, В., Баккерс, М. Дж., Де Гроот, Р. Дж. И др. (2017). Мутация второго сайта связывания сиаловой кислоты, приводящая к снижению активности нейраминидазы, предшествовала появлению вируса гриппа H7N9. J. Virol. 91: e00049-17. DOI: 10.1128 / JVI.00049-17

PubMed Аннотация | CrossRef Полный текст | Google Scholar

De Vries, E., Tscherne, D.M., Wienholts, M.J., Cobos-Jiménez, V., Scholte, F., García-Sastre, A., et al. (2011). Изучение эндоцитарных путей вируса гриппа А выявляет макропиноцитоз как альтернативный путь проникновения. PLoS Pathog. 7: e1001329. DOI: 10.1371 / journal.ppat.1001329

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Doss, M., White, M. R., Tecle, T., Gantz, D., Crouch, E.C., Jung, G., et al. (2009). Взаимодействие α-, β- и θ-дефенсинов с вирусом гриппа A и сурфактантным белком D. J. Immunol. 182, 7878–7887. DOI: 10.4049 / jimmunol.0804049

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Доу Д., Револь Р., Остбай Х., Ван Х. и Дэниелс Р. (2018). Вхождение в клетку вируса гриппа А, репликация, сборка и перемещение вирионов. Фронт. Иммунол. 9: 1581. DOI: 10.3389 / fimmu.2018.01581

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Du, W., Guo, H., Nijman, V.S., Doedt, J., van der Vries, E., van der Lee, J., et al. (2019). Второй сайт связывания сиаловой кислоты нейраминидазы вируса гриппа A является важным детерминантом баланса гемагглютинин-нейраминидаза-рецептор. PLoS Pathog. 15: e1007860. DOI: 10.1371 / journal.ppat.1007860

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гойцука, Р., Чен-ло, Х. К., Беньон, Л., Асано, Ю., Китамура, Д., и Купер, М. Д. (2007). Куриный кателицидин-B1, антимикробный защитник М-клеток слизистой оболочки. Proc. Natl. Акад. Sci. 104, 15063–15068. DOI: 10.1073 / pnas.0707037104

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гуо, Х., Рабоу, Х., Сломп, А., Дай, М., ван дер Вегт, Ф., ван Лент, Дж. У. и др. (2018). Кинетический анализ баланса HA / NA вируса гриппа A показывает вклад NA в связывание вируса с рецептором и NA-зависимое катание на рецепторсодержащих поверхностях. PLoS Pathog. 14: e1007233. DOI: 10.1371 / journal.ppat.1007233

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Хартсхорн, К.Л., Уайт, М. Р., Текле, Т., Холмсков, У., и Крауч, Э. К. (2006). Врожденная защита от вируса гриппа A: активность дефенсинов нейтрофилов человека и взаимодействия дефенсинов с сурфактантным белком D. J. Immunol. 176, 6962–6972. DOI: 10.4049 / jimmunol.176.11.6962

CrossRef Полный текст | Google Scholar

Högner, K., Wolff, T., Pleschka, S., Plog, S., Gruber, A.D., Kalinke, U., et al. (2013). Экспрессируемый макрофагами IFN-β способствует апоптотическому повреждению альвеолярных эпителиальных клеток при тяжелой пневмонии, вызванной вирусом гриппа. PLoS Pathog. 9: e1003188. DOI: 10.1371 / journal.ppat.1003188

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Хазени Н., Хаттон Д. В., Коллинз К. И., Гарбер А. М. и Оуэнс Д. К. (2014). Польза для здоровья и экономики от ранней вакцинации и нефармацевтических вмешательств при пандемии гриппа человека A (H7N9): модельное исследование. Ann. Междунар. Med. 160, 684–694. DOI: 10.7326 / m13-2071

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ким, Х.М., Ли, Й.-В., Ли, К.-Дж., Ким, Х.С., Чо, С.В., Ван Ройджен, Н. и др. (2008). Альвеолярные макрофаги незаменимы для борьбы с вирусами гриппа в легких свиней. J. Virol. 82, 4265–4274. DOI: 10.1128 / JVI.02602-07

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Коэль, Б. Ф., Берк, Д. Ф., Бестеброер, Т. М., ван дер Влит, С., Зондаг, Г. К., Вервет, Г. и др. (2013). Замены возле сайта связывания рецептора определяют основные антигенные изменения во время эволюции вируса гриппа. Наука 342, 976–979. DOI: 10.1126 / science.1244730

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Лай, Дж. К. С., Карунаратна, Х. М., Вонг, Х. Х., Пейрис, Дж. С., и Николлс, Дж. М. (2019). На активность нейраминидазы и специфичность вируса гриппа А влияет связывание гемагглютинина с рецептором. Emerg. Microb. Заразить. 8, 327–338. DOI: 10.1080 / 22221751.2019.1581034

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Петерс, Б., Reemers, S., Dortmans, J., de Vries, E., de Jong, M., van de Zande, S., et al. (2017). Генетические и антигенные различия между высокопатогенными вирусами птичьего гриппа A H5N1: последствия для выбора вакцинного штамма. Вирусология 503, 83–93. DOI: 10.1016 / j.virol.2017.01.012

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Родригес-Лекомпте, Дж., Итбарек, А., Куперус, Т., Эчеверри, Х., Ван Дейк, А. (2016). Иммуномодулирующий эффект витамина D у кур зависит от дозы и зависит от уровня кальция и фосфора. Poult. Sci. 95, 2547–2556. DOI: 10.3382 / пс / pew186

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Райан, Л. К., Дай, Дж., Инь, З., Мегджугорак, Н., Ульхорн, В., Йим, С. и др. (2011). Модуляция человеческого β-дефенсина-1 (hBD-1) в плазматических дендритных клетках (PDC), моноцитах и ​​эпителиальных клетках вирусом гриппа, вирусом простого герпеса и вирусом Сендай и его возможная роль в врожденном иммунитете. J. Leukoc. Биол. 90, 343–356. DOI: 10.1189 / jlb.0209079

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Секелова З., Степанова Х., Полянский О., Вармузова К., Фалдынова М., Федр Р. и др. (2017). Дифференциальная экспрессия белка в макрофагах и гетерофилах кур in vivo после заражения Salmonella Enteritidis. Вет. Res. 48:35. DOI: 10.1186 / s13567-017-0439-0

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Сункара, Л. Т. (2011). Повышение врожденного иммунитета и устойчивости цыплят к болезням за счет усиления синтеза защитных пептидов хозяина. Стиллуотер, Оклахома: Государственный университет Оклахомы.

Google Scholar

Трипати, С., Текле, Т., Верма, А., Крауч, Э., Уайт, М., и Хартсхорн, К. Л. (2013). Кателицидин человека LL-37 ингибирует вирусы гриппа A по механизму, отличному от сурфактантного протеина D или дефенсинов. J. Gen. Virol. 94 (Pt 1), 40–49. DOI: 10.1099 / vir.0.045013-0

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Трипати, С., Ван, Г., Уайт, М., Ци, Л., Таубенбергер, Дж., И Хартсхорн, К. Л. (2015). Противовирусная активность человеческого кателицидина, LL-37 и производных пептидов в отношении вирусов сезонного и пандемического гриппа А.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *