Спрей звездочка ноз инструкция по применению: Звездочка НОЗ инструкция по применению: показания, противопоказания, побочное действие – описание Zvezdochka NOZ капли назальные 0.05%: 10 мл фл. (30677)

Звездочка ноз 0.1% 15мл спрей наз. №1 фл.расп. (Лпп фарм ооо)

Выберите районАкадемическийБотаническийВторчерметВТУЗгородкаЗаречныйКомпрессорныйКомсомольский (ЖБИ)Новая СортировкаПарковыйПионерскийСолнечныйУктусскийУралмашХиммашЦентральныйШарташскийЭльмашЮго-ЗападныйЮжный (Автовокзал)ВИЗМичуринский поселок

Выберите аптекуул.Баумана;д.51ул.Бебеля;д.136ул.Волгоградская;д.190ул.Пехотинцев;д.4/1ул.Грибоедова;д.12ул.Военная;д.1аул.Бебеля;д.156ул.Сыромолотова;д.14ул.Мичурина;д.210ул.Бебеля;д.125ул.40-летия Комсомола;д.14ул.Заводская;д.17ул.Крауля;д.4ул.Луначарского;д.136пр-кт Ленина;д.70ул.Луначарского;д.74ул.Сулимова;д.50ул.Павла Шаманова;д.28ул.Луначарского д.217ул.Татищева;д.56ул.Владимира Высоцкого;д.12ул.Культуры;д.44ТЦ Гагарин ул.Сибирский тракт;д.8 Н ул.Академика Шварца;д.1пр-кт Космонавтов;д.72ул.Таватуйская;д.14ул.Айвазовского;д.53ул.Московская;д.35ул.Челюскинцев;д.62ул.Татищева;д.90ул.Гагарина д.22пр-кт Ленина 41/ул.Толмачева 16пр-кт Ленина;д.48ул.Крауля;д.51ул.Фрунзе;д.96ул.Машиностроителей;д.20ул.Восстания;д.91пр-кт Орджоникидзе;д.19ул.Вайнера;д.10ул.Белинского;д.222ул.8 Марта;д.149ул.Чапаева;д.30ул.Амундсена;д.63ул.Амундсена;д.65ул.Декабристов;д.16/18ул.Щербакова;д.4ул.40-летия Комсомола;д.38пер.Суворовский;д.3ул.Крауля;д.48,корп.1ул.Сулимова;д.23ул.Краснолесья;д.133ул.Пальмиро Тольятти;д.28 Аул. Сурикова, д.28ул.Счастливая;д.4ул.Малышева; д.84ул.Санаторная;д.8ул.Тверитина;д.38 корп.1ул. Амундсена; д.68ул.Радищева;д.33ул. Комсомольская;д.4ул.Уральская, д.61 АЛатвийская ул,16ул.Опалихинская;д.31ул.Восточная;д.7 Жул.Гурзуфская;д.16ТЦ Фан Фан Ясная, 2 ТЦ Алатырь Малышева, 5 пр-кт Космонавтов,41ул.Сухоложская,4ул Баумана;д.3Рощинская ул,29Космонавтов пр-кт, дом № 104Патриотов ул, строение 1Сиреневый б-р,д.1Вильгельма де Геннина ул, д.37ул.Ручейная,д.53Большакова ул, д147Чкалова ул, д.239Агрономическая ул, д.30Ак. Шварца ул, д.12, корп. 2 литАИнженерная ул, д.31Ак. Бардина,д.48Опалихинская ул, д.16Латвийская ул, д.55Куйбышева ул, д.159аРодонитовая ул, д.18Ак. Парина ул, д.40/3

Звездочка-ноз спрей наз 0,1% фл-кап 15мл

Форма выпуска

Спрей назальный

Состав

15 мл раствора содержат: Ксилометазолина гидрохлорида 15 мг;

вспомогательные вещества: натрия дигидрофосфат, натрия гидрофосфат, натрия хлорид, бензалкония хлорид, вода очищенная

Упаковка

Флакон 15 мл.

Фармакологическое действие

Звездочка Ноз – сосудосуживающее средство для назального применения,. альфа-адреностимулятор, сужает кровеносные сосуды слизистой оболочки полости носа, устраняя отек и гиперемию слизистой оболочки. Облегчает носовое дыхание при ринитах. Действие наступает через несколько минут и продолжается в течение нескольких часов.

Показания

Острый аллергический ринит, ОРЗ с явлениями ринита, синусит, поллиноз; средний отит (для уменьшения отека слизистой оболочки носоглотки). Подготовка больного к диагностическим манипуляциям в носовых ходах.

Противопоказания

Индивидуальная непереносимость компонентов препарата, артериальная гипертензия, тахикардия, выраженный атеросклероз, глаукома, атрофический ринит, тиреотоксикоз, хирургические вмешательства на мозговых оболочках (в анамнезе), беременность, детский возраст (до 6 лет).

С осторожностью:

период лактации, ИБС (стенокардия), гиперплазия предстательной железы, сахарный диабет. Способ применения и дозы

Интраназально. Взрослым и детям старше 6 лет: по 3 впрыскивания в каждый носовой ход 2-3 раза в день. Не использовать более 3 раз в день. Применяют в течение 7-14 дней.

Побочные действия

При применении может вызывать жжение в носу и горле, местное раздражение, парестезии, чиханье, гиперсекрецию, сухость слизистой оболочки носа. Возможны аллергические реакции. Редко – отек слизистой оболочки носа, сердцебиение, тахикардия, аритмии, повышение АД, головная боль, тошнота, рвота, бессонница, нарушение зрения; депрессия ( при длительном применении в высоких дозах). При возникновении симптомов прекратить использование препарата и обратиться к врачу.

Особые указания

Не рекомендуется частое и длительное применение при хронических заболеваниях носоглотки. При «простудных» заболеваниях в тех случаях, когда в носу образуются корки, предпочтительно назначать в виде геля.

Лекарственное взаимодействие

Не использовать одновременно с ингибиторами МАО и трициклическими антидепрессантами.

Условия хранения

Хранить в сухом месте при температуре не выше +25°С.

Можно ли детям бальзам звездочка: применение и ограничения

Время чтения этой статьи: 7 мин.

Бальзам звёздочка, разработанный вьетнамскими учёными во второй половине прошлого века – замечательное средство от многих заболеваний и их симптомов. Применяется он как наружное средство с целью лечения, а также и для профилактики. Несмотря на то, что это очень недорогое средство, оно весьма эффективно для борьбы с воспалениями, с симптомами простуды и др.

Бальзам звездочка можно применять и для детей

Родители часто интересуются, можно ли использовать этот бальзам для детей в качестве лечебного средства. Можно ли натирать ребёнка звёздочкой при простуде? Для того чтобы ответить на эти вопросы, нужно ознакомиться с тем, что входит в состав этого средства.

Из чего состоит бальзам звёздочка

Этот препарат включает в себя только натуральные природные компоненты. В нём содержатся эфирные масла целебных растений: гвоздичное, камфорное, коричное, эвкалиптовое, ментоловое. Каждое из этих масел обладает лечебными свойствами. А в комплексе они дают особенный эффект. Он хорошо известен как средство для избавления от воспалительных процессов на поверхности кожных покровов и слизистых оболочек, а также устранения отёков, снятия зуда и раздражения, облегчения болей.

В качестве формообразующих средств используются безводный ланолин, пчелиный воск, вазелиновое масло, парафин. Они придают густоту и пластичность и способствуют длительному удержанию бальзама на поверхности кожи.

Звёздочка выпускается в разных формах, а не только в виде мази. Среди них ингаляционный карандаш, капли для носа, спрей, а также специальный охлаждающий пластырь.

Словом, полностью натуральный состав этого лекарственного средства позволяет с успехом использовать его при наличии патологических процессов для скорейшего избавления от них.

Фармакологические свойства бальзама

Этот препарат обладает множеством полезных свойств, которые эффективно воздействуют на организм человека и справляются с болезненным состоянием кожи и слизистых оболочек. Все компоненты, входящие в его состав, хорошо известны в медицинской и фармакологической промышленности.

К примеру, камфорное масло обладает выраженным обеззараживающим действием, потому его используют как антисептик. Аналогичные свойства и у эвкалиптового и коричного масла, они тоже оказывают антисептический эффект. А эвкалиптовое масло кроме этого ещё способно обезвреживать патогенные микроорганизмы и вирусы. Это свойство имеют также гвоздичное и ментоловое масло. Поэтому бальзам очень хорошо защищает организм от проникновения вирусов и бактерий. Звёздочка замечательно устраняет болевые ощущения, так как ментоловое масло имеет и такое действие. Коричное масло раздражающе воздействует на кожные рецепторы, что тоже снимает боль.

Помимо перечисленного, в состав бальзама включается ещё муравьиная кислота. Она усиливает действие всех компонентов и сама обладает способностью бороться с воспалениями, облегчать боль, согревать и усиливать защитные силы организма.

Возможно включение в состав бальзама звёздочка и других ингредиентов. Информация об этом содержится в аннотации.

Как применять звёздочку для лечения детей

Лечение ребёнка, разумеется, отличается от лечения взрослого человека. Ведь детский организм ещё не окреп. Поэтому не всегда можно использовать даже самые эффективные лекарственный средства, чтобы не нанести ему вред. Это относится и к использованию бальзама звёздочка. Можно ли звездочку детям? Ответ на этот вопрос неоднозначен.

В инструкции по применению этого средства всегда указывается, что использовать его для детей моложе двух лет запрещено. Входящие в состав звёздочки компоненты могут вызвать сильную аллергическую реакцию организма, нанести ожоги на нежную кожу и слизистые.

Что касается детей 3 лет и старше, то и для них не всегда можно свободно применять этот препарат. Рекомендуется перед использованием проконсультироваться с педиатром.

Бальзам звездочка в раскрытом виде

Проверка на переносимость препарата

Чтобы решить, можно ли можно ли мазать звездочкой ребенка, необходимо установить, страдает он аллергией, или нет. При этом имеет значение аллергия не только на это средство, но и на совершенно другие раздражители: пыль, пух, цветочная пыльца, шерсть животных, медицинские препараты. Если малыш аллергичен, то применение звёздочки нежелательно, т. к. сложно сказать, как отреагирует организм. Ведь в составе этого средства содержатся эфирные масла, которые могут стать причиной достаточно тяжёлой реакции. Кроме того, следует учитывать, насколько родители малыша сами склонны к аллергии на компоненты этого препарата. Если организм кого-то из них или обоих плохо переносит эти средства, то вполне возможно, что у малыша проявится какая же реакция.

Проверить переносимость препарата организмом ребёнка можно, нанеся очень небольшое количество на руку. Если в течение 15 минут не появилось покраснения и зуда, то аллергии у ребёнка нет, и можно использовать средство для лечения. Если же такие симптомы появились, то непременно нужно смыть его тёплой водой с мылом.

В случае полного отсутствия отрицательной реакции организма можно использовать бальзам звёздочка для лечения малышей при некоторых заболеваниях. К примеру, это средство совсем неплохо помогает избавиться от насморка.

Родители спрашивают специалистов о том, можно ли ребенку мазать нос звездочкой при простудном рините. Педиатры считают, что это допустимо. Но непременно следует помнить, что делать это нужно с учётом некоторых моментов. Во-первых, наносить это средство можно только на наружную часть носа тонким слоем, а также небольшое количество наносится над верхней губой и на подбородок. Нельзя допускать, чтобы оно попало внутрь, на слизистые носовой полости. Это вызовет сильное ощущение жжения, которое будет мучительно для ребёнка. Также нужно следить за тем, чтобы не попало в глаза, по той же самой причине. И обязательно наблюдать, чтобы ребёнок не трогал руками намазанный бальзамом нос, не стёр его и затем не почесал глаза.

Можно ли детям бальзам звездочка при кашле

Использование звёздочки для лечения кашля у детей тоже необходимо проводить только после консультации с педиатром. Прежде всего нужно отметить, что кашель у детей обычно бывает вызван простудными заболеваниями. А звёздочка хорошо справляется с симптомами простуды.

Однако она не способна избавить ребёнка от её причины. Но всё же бальзам способствует разжижению мокроты в верхних дыхательных путях и выведению её, что и облегчает кашель. Кроме того, благодаря обезболивающему эффекту и противовоспалительным свойствам, состояние организма улучшится, и будет заметно облегчение. Поэтому применять этот препарат для избавления малыша от кашля можно в комплексе с другими видами лечения. Лишь так будет достигнут желаемый эффект.

Если родители приняли решение использовать бальзам звёздочка для лечения кашля у ребёнка, то они должны непременно помнить несколько простых правил.

  1. Во-первых, дозировка применения препарата. Нужно придерживаться той, которую назначил лечащий врач и не заниматься самодеятельностью. Иначе можно вызвать отрицательную реакцию и ухудшить состояние и без того больного ребёнка.
  2. Во-вторых, для наибольшей эффективности все процедуры для лечения кашля следует проводить перед сном. Именно в этом случае они принесут набольшую пользу организму малыша.

Наносить мазь нужно при этом на определённые точки. В частности, в области грудины (на её верхней части), а также на спине, между лопаток. Также нужно нанести тонкий слой бальзама на ножки ребёнка. А именно – на стопы снизу, и затем непременно надеть лёгкие носочки. После этого малыша сразу же следует уложить спать, тепло укрыв его одеялом.

Если на коже имеются механические повреждения – ссадины, царапины, ожоги или порезы и др., а также гнойнички или папилломы, то нельзя наносить этот препарат, т. к. появится жжение и зуд.

Для детей старше 5-летнего возраста можно применять ингаляции с использованием бальзама звёздочка. Для этого следует добавить небольшое количество (с горошину) на 0,5 л кипятка и дать ребёнку подышать паром в течение нескольких минут. После этого ребёнка также нужно уложить в постель и укрыть.

Когда категорически нельзя использовать бальзам звёздочка для лечения детей

Как и любое лекарственное средство, звёздочка тоже не может подходить абсолютно всегда и всем. Выше уже было сказано, что этот препарат не подходит для совсем маленьких детей (моложе 2-летнего возраста), а также детей, имеющих аллергию или индивидуальную непереносимость организмом одного или нескольких компонентов препарата.

Кроме того, категорически нельзя использовать звёздочку для лечения малышей, страдающих бронхиальной астмой, коклюшем, некоторыми кожными заболеваниями.

Применение звёздочки для лечения укусов насекомых

Нежная детская кожа очень болезненно реагирует на укусы насекомых. Помимо острых болевых ощущений появляется сильный зуд, жжение, покраснение, повышение местной температуры. Бальзам звёздочка очень хорошо отпугивает кровососущих насекомых. Поэтому в летний период можно использовать его в целях профилактики. Для этого следует нанести очень небольшое количество на поверхность кожи ребёнка в нескольких местах, например перед тем, как отправиться на прогулку. Это позволит предупредить укусы. И ребёнок не будет страдать от нестерпимого зуда.

Если же укусы уже появились, то можно смазать тонким слоем звёздочки кожу в этих местах. Раздражающее действие бальзама вызовет усиленный приток крови, и облегчение наступит довольно быстро, в течение нескольких минут. Хороший эффект даст использование звёздочки даже тогда, когда ребёнка ужалила пчела или оса. При этом следует сразу же вытащить жало и смазать поражённое место бальзамом. И он непременно принесёт облегчение.

Словом, бальзам звёздочка – замечательное средство для лечения взрослых и детей, если правильно использовать его.

%PDF-1.4 % 1041 0 объект > эндообъект внешняя ссылка 1041 119 0000000016 00000 н 0000003760 00000 н 0000003954 00000 н 0000003990 00000 н 0000004231 00000 н 0000004339 00000 н 0000004447 00000 н 0000004823 00000 н 0000005999 00000 н 0000007179 00000 н 0000008362 00000 н 0000009546 00000 н 0000009584 00000 н 0000009634 00000 н 0000009684 00000 н 0000009884 00000 н 0000010095 00000 н 0000010305 00000 н 0000010408 00000 н 0000010628 00000 н 0000010730 00000 н 0000014924 00000 н 0000019043 00000 н 0000023067 00000 н 0000026965 00000 н 0000027092 00000 н 0000030945 00000 н 0000035090 00000 н 0000039165 00000 н 0000043307 00000 н 0000045978 00000 н 0000058591 00000 н 0000071378 00000 н 0000082189 00000 н 0000095004 00000 н 0000095834 00000 н 0000099083 00000 н 0000099892 00000 н 0000101433 00000 н 0000102131 00000 н 0000102189 00000 н 0000102416 00000 н 0000102623 00000 н 0000103066 00000 н 0000103124 00000 н 0000121954 00000 н 0000121994 00000 н 0000122470 00000 н 0000122584 00000 н 0000123057 00000 н 0000123166 00000 н 0000123639 00000 н 0000123748 00000 н 0000124191 00000 н 0000124249 00000 н 0000147697 00000 н 0000147737 00000 н 0000148212 00000 н 0000148326 00000 н 0000148386 00000 н 0000148490 00000 н 0000148600 00000 н 0000148736 00000 н 0000148854 00000 н 0000149004 00000 н 0000149120 00000 н 0000149246 00000 н 0000149346 00000 н 0000149487 00000 н 0000149613 00000 н 0000149733 00000 н 0000149891 00000 н 0000150025 00000 н 0000150153 00000 н 0000150313 00000 н 0000150427 00000 н 0000150553 00000 н 0000150703 00000 н 0000150803 00000 н 0000150949 00000 н 0000151093 00000 н 0000151246 00000 н 0000151358 00000 н 0000151476 00000 н 0000151628 00000 н 0000151786 00000 н 0000151886 00000 н 0000152030 00000 н 0000152134 00000 н 0000152238 00000 н 0000152374 00000 н 0000152516 00000 н 0000152624 00000 н 0000152762 00000 н 0000152918 00000 н 0000153040 00000 н 0000153174 00000 н 0000153312 00000 н 0000153442 00000 н 0000153582 00000 н 0000153696 00000 н 0000153842 00000 н 0000153990 00000 н 0000154188 00000 н 0000154310 00000 н 0000154458 00000 н 0000154610 00000 н 0000154810 00000 н 0000154984 00000 н 0000155146 00000 н 0000155274 00000 н 0000155392 00000 н 0000155518 00000 н 0000155650 00000 н 0000155782 00000 н 0000155924 00000 н 0000156068 00000 н 0000156188 00000 н 0000002676 00000 н трейлер ]>

> startxref 0 %%EOF 1159 0 объект>поток xb“`f`6c`c“ À

%PDF-1.6 % 1 0 объект > эндообъект 2 0 объект >поток конечный поток эндообъект 3 0 объект >

эндообъект 5 0 объект >поток hlTmo0ίO1`ЦiN-kѪ8T;ہd/A swZ{ׅwYP(V$AG$C ƻ3(5uxFAQb-!v !&PL-(3_\H$Jo->7x *KUXT)OA#`[email protected]’k)Uہvodc−ɢY¶k+{(FG9 R:hJԥJԱfzLE9ɯ-瓏8>7Z%0Zu z ǘJV];jLh3+E5vv{ M{ 9Njl]e1^ث%L;ulA~hECpF,`wJUf?ʭ vO0%!C2W#h#;”SoQe 9]$c)]nwQԺ:Qc\M9pN48c 2k ! ÎWٛƇ|Y3lT8ַJ_2ZJDVԉqa6Jrpj{0>Ӳ XDRfhy8V9W;nGZÎ?Bw Sx/i/O)d`1#[email protected]’JbN%&i}

%PDF-1.2 % 1 0 объект > эндообъект 2 0 объект > эндообъект 3 0 объект > эндообъект 4 0 объект > эндообъект 5 0 объект > эндообъект 6 0 объект > эндообъект 7 0 объект > эндообъект 8 0 объект > эндообъект 9 0 объект > эндообъект 10 0 объект > эндообъект 11 0 объект > эндообъект 12 0 объект > эндообъект 13 0 объект > эндообъект 14 0 объект > эндообъект 15 0 объект > эндообъект 16 0 объект > эндообъект 17 0 объект > эндообъект 18 0 объект > эндообъект 19 0 объект > эндообъект 20 0 объект > эндообъект 21 0 объект > эндообъект 22 0 объект > эндообъект 23 0 объект > эндообъект 24 0 объект > эндообъект 25 0 объект > эндообъект 26 0 объект > эндообъект 27 0 объект > эндообъект 28 0 объект > эндообъект 29 0 объект > эндообъект 30 0 объект > эндообъект 31 0 объект > эндообъект 32 0 объект > эндообъект 33 0 объект > эндообъект 34 0 объект > эндообъект 35 0 объект > эндообъект 36 0 объект > эндообъект 37 0 объект > эндообъект 38 0 объект > эндообъект 39 0 объект > эндообъект 40 0 объект > эндообъект 41 0 объект > эндообъект 42 0 объект > эндообъект 43 0 объект > эндообъект 44 0 объект > эндообъект 45 0 объект > эндообъект 46 0 объект > эндообъект 47 0 объект > эндообъект 48 0 объект > эндообъект 49 0 объект > эндообъект 50 0 объект > эндообъект 51 0 объект > эндообъект 52 0 объект > эндообъект 53 0 объект > эндообъект 54 0 объект > эндообъект 55 0 объект > эндообъект 56 0 объект > эндообъект 57 0 объект > эндообъект 58 0 объект > эндообъект 59 0 объект > эндообъект 60 0 объект > эндообъект 61 0 объект > эндообъект 62 0 объект > эндообъект 63 0 объект > эндообъект 64 0 объект > эндообъект 65 0 объект > эндообъект 66 0 объект > эндообъект 67 0 объект > эндообъект 68 0 объект > эндообъект 69 0 объект > эндообъект 70 0 объект > эндообъект 71 0 объект > эндообъект 72 0 объект > эндообъект 73 0 объект > эндообъект 74 0 объект > эндообъект 75 0 объект > эндообъект 76 0 объект > эндообъект 77 0 объект > эндообъект 78 0 объект > эндообъект 79 0 объект > эндообъект 80 0 объект > эндообъект 81 0 объект > эндообъект 82 0 объект > эндообъект 83 0 объект > эндообъект 84 0 объект > эндообъект 85 0 объект > эндообъект 86 0 объект > эндообъект 87 0 объект > эндообъект 88 0 объект > эндообъект 89 0 объект > эндообъект 90 0 объект > эндообъект 91 0 объект > эндообъект 92 0 объект > эндообъект 93 0 объект > эндообъект 94 0 объект > эндообъект 95 0 объект > эндообъект 96 0 объект > эндообъект 97 0 объект > эндообъект 98 0 объект > эндообъект 99 0 объект > эндообъект 100 0 объект > эндообъект 101 0 объект > эндообъект 102 0 объект > эндообъект 103 0 объект > эндообъект 104 0 объект > эндообъект 105 0 объект > эндообъект 106 0 объект > эндообъект 107 0 объект > эндообъект 108 0 объект > эндообъект 109 0 объект > эндообъект 110 0 объект > эндообъект 111 0 объект > эндообъект 112 0 объект > эндообъект 113 0 объект > эндообъект 114 0 объект > эндообъект 115 0 объект > эндообъект 116 0 объект > эндообъект 117 0 объект > эндообъект 118 0 объект > эндообъект 119 0 объект > эндообъект 120 0 объект > эндообъект 121 0 объект > эндообъект 122 0 объект > эндообъект 123 0 объект > эндообъект 124 0 объект > эндообъект 125 0 объект > эндообъект 126 0 объект > эндообъект 127 0 объект > эндообъект 128 0 объект > эндообъект 129 0 объект > эндообъект 130 0 объект > эндообъект 131 0 объект > эндообъект 132 0 объект > эндообъект 133 0 объект > эндообъект 134 0 объект > эндообъект 135 0 объект > эндообъект 136 0 объект > эндообъект 137 0 объект > эндообъект 138 0 объект > эндообъект 139 0 объект > эндообъект 140 0 объект > эндообъект 141 0 объект > эндообъект 142 0 объект > эндообъект 143 0 объект > эндообъект 144 0 объект > эндообъект 145 0 объект > эндообъект 146 0 объект > эндообъект 147 0 объект > эндообъект 148 0 объект > эндообъект 149 0 объект > эндообъект 150 0 объект > эндообъект 151 0 объект > эндообъект 152 0 объект > эндообъект 153 0 объект > эндообъект 154 0 объект > эндообъект 155 0 объект > эндообъект 156 0 объект > эндообъект 157 0 объект > эндообъект 158 0 объект > эндообъект 159 0 объект > эндообъект 160 0 объект > эндообъект 161 0 объект > эндообъект 162 0 объект > эндообъект 163 0 объект > эндообъект 164 0 объект > эндообъект 165 0 объект > эндообъект 166 0 объект > эндообъект 167 0 объект > эндообъект 168 0 объект > эндообъект 169 0 объект > эндообъект 170 0 объект > эндообъект 171 0 объект > эндообъект 172 0 объект > эндообъект 173 0 объект > эндообъект 174 0 объект > эндообъект 175 0 объект > эндообъект 176 0 объект > эндообъект 177 0 объект > эндообъект 178 0 объект > эндообъект 179 0 объект > эндообъект 180 0 объект > эндообъект 181 0 объект > эндообъект 182 0 объект > эндообъект 183 0 объект > эндообъект 184 0 объект > эндообъект 185 0 объект > эндообъект 186 0 объект > эндообъект 187 0 объект > эндообъект 188 0 объект > эндообъект 189 0 объект > эндообъект 190 0 объект > эндообъект 191 0 объект > эндообъект 192 0 объект > эндообъект 193 0 объект > эндообъект 194 0 объект > эндообъект 195 0 объект > эндообъект 196 0 объект > эндообъект 197 0 объект > эндообъект 198 0 объект > эндообъект 199 0 объект > эндообъект 200 0 объект > эндообъект 201 0 объект > эндообъект 202 0 объект > эндообъект 203 0 объект > эндообъект 204 0 объект > эндообъект 205 0 объект > эндообъект 206 0 объект > эндообъект 207 0 объект > эндообъект 208 0 объект > эндообъект 209 0 объект > эндообъект 210 0 объект > эндообъект 211 0 объект > эндообъект 212 0 объект > эндообъект 213 0 объект > эндообъект 214 0 объект > эндообъект 215 0 объект > эндообъект 216 0 объект > эндообъект 217 0 объект > эндообъект 218 0 объект > эндообъект 219 0 объект > эндообъект 220 0 объект > эндообъект 221 0 объект > эндообъект 222 0 объект > эндообъект 223 0 объект > эндообъект 224 0 объект > эндообъект 225 0 объект > эндообъект 226 0 объект > эндообъект 227 0 объект > поток ух `hd D!l.pq 6б21 !9Ng9hb)*a”

%PDF-1.7 % 31 0 объект > эндообъект внешняя ссылка 31 74 0000000016 00000 н 0000002270 00000 н 0000002442 00000 н 0000003093 00000 н 0000003227 00000 н 0000003474 00000 н 0000003889 00000 н 0000004267 00000 н 0000004769 00000 н 0000004880 00000 н 0000005361 00000 н 0000005620 00000 н 0000005655 00000 н 0000005768 00000 н 0000005881 00000 н 0000006337 00000 н 0000006590 00000 н 0000006615 00000 н 0000007200 00000 н 0000007818 00000 н 0000009323 00000 н 0000009786 00000 н 0000010289 00000 н 0000010556 00000 н 0000011006 00000 н 0000011279 00000 н 0000011793 00000 н 0000013625 00000 н 0000014833 00000 н 0000015094 00000 н 0000015449 00000 н 0000015866 00000 н 0000016293 00000 н 0000016546 00000 н 0000016994 00000 н 0000018692 00000 н 0000018974 00000 н 0000020707 00000 н 0000020836 00000 н 0000020861 00000 н 0000021347 00000 н 0000022914 00000 н 0000024274 00000 н 0000026161 00000 н 0000026421 00000 н 0000049523 00000 н 0000087497 00000 н 0000087577 00000 н 0000087646 00000 н 0000110576 00000 н 0000111010 00000 н 0000111276 00000 н 0000138775 00000 н 0000138855 00000 н 0000171391 00000 н 0000171460 00000 н 0000171833 00000 н 0000206995 00000 н 0000209644 00000 н 0000231117 00000 н 0000255296 00000 н 0000278041 00000 н 0000278153 00000 н 0000293091 00000 н 0000293358 00000 н 0000293703 00000 н 0000308321 00000 н 0000328586 00000 н 0000328621 00000 н 0000337883 00000 н 0000358223 00000 н 0000359831 00000 н 0000366144 00000 н 0000001776 00000 н трейлер ]/предыдущая 517120>> startxref 0 %%EOF 104 0 объект >поток hb“`b“`A؀,]}(Ho“8x1eY*~Tv8uiKKnpGFiBEץ]v&tCA=,QpNeuaZA;WIl466v Т.tA “W γ”, TĐp1.C W\

Прочтите мелкий шрифт — Асептическое здоровье

Андреа Веласкес
Менеджер по работе с клиентами и сертифицированный специалист Clinically Clean®

Андреа является сертифицированным клинически чистым специалистом. Помимо других обязанностей, Андреа обрабатывает запросы от клиентов Aseptic Health по всей стране и помогает нашей сети сертифицированных операторов SanitizeIT®. В течение многих лет Андреа была вице-президентом по развитию бизнеса крупной проектной и строительной компании в Чикаго.Другими словами, чтение и понимание мелкого шрифта — ее специальность! Вот мнение Андреа после прочтения мелким шрифтом нескольких дезинфицирующих средств.

В эпоху Covid-19 и других новых патогенов чтение мелкого шрифта на чистящих средствах становится еще более важным. Многое из того, что вы читаете на лицевой стороне этикетки, связано с маркетингом и рекламой. Но мелкий шрифт — это то, где вы найдете инструкции по применению и то, что продукт может и не может делать.

Начнем с Lysol

Сколько дверных ручек и ручек унитаза вы обрызгали лизолом в сезон простуды и гриппа? Знаете ли вы, что, согласно инструкции по применению и веб-сайту Lysol.com, вам необходимо предварительно очистить поверхность, распылить в течение 6–7 секунд, пока она не покроется туманом, а затем оставить на 3 минуты, чтобы убить 99,9% бактерий, вирусов и грибы? Также мелким шрифтом: если ваши светильники изготовлены из латуни, меди или алюминия, Lysol использовать не рекомендуется.

Многие родители и учителя также используют лизол для дезинфекции игрушек в детской, но не ополаскивают их после того, как туман высохнет.На этикетке четко указано, что игрушки и поверхности, контактирующие с пищевыми продуктами, после использования необходимо промывать питьевой водой.

Кроме того, существуют разные периоды времени для уничтожения вирусов и бактерий. Для дезинфекции: поверхности должны оставаться влажными в течение 3 минут, затем дать высохнуть на воздухе. Для норовируса поверхности должны оставаться влажными в течение 10 минут, а затем дать высохнуть на воздухе.

А барьеры?

Мы видим, что на рынок выводится все больше и больше барьерных продуктов в качестве долговременной защиты от патогенов.Чистящие средства Microban 24 Hour Cleaning, вероятно, являются одними из самых известных. На веб-сайте написано: «Знаете ли вы, что бактерии могут жить на поверхностях от нескольких часов до нескольких дней… Созданный на основе антимикробной технологии, Microban 24 обеспечивает дезинфекцию поверхностей до 24 часов даже после многочисленных прикосновений*. Звездочка означает мелкий шрифт: * При использовании по назначению.

Продолжая копать в деталях, Microban признает, что Microban 24 не обеспечивает остаточной 24-часовой защиты от вирусов простуды и гриппа.

Итак, что делает продукт? При использовании по назначению он обеспечивает многослойный защитный экран на поверхности, который связывает борющийся с бактериями ингредиент на поверхности даже при многократном контакте. Это отличная новость, но, не читая мелкий шрифт, вы могли бы поверить, что вы также защищены от коронавируса или вирусов гриппа в течение 24 часов, но это неправда.

Сделай сам?

Электролизованная вода, приготовленная из соли, уксуса и воды и подвергнутая электролизу для получения хлорноватистой кислоты, в течение многих лет использовалась для безопасного уничтожения 99 человек.9% бактерий и вирусов на поверхностях. Проблема с электролизованной водой заключается в том, что она дорога в производстве и не имеет очень длительного срока хранения. Таким образом, для уборочной компании время, необходимое для смешивания больших количеств каждый день, является неудобным. Тем не менее, нам нравится тот факт, что он сделан из натуральных ингредиентов.

Сегодня существует бытовая техника, позволяющая самостоятельно приготовить недорогую электролизованную воду под названием «Сила природы». Согласно веб-сайту, Force of Nature «эффективен, как отбеливатель» при убийстве 99 человек.9% микробов. И хотя это может звучать как почти 100%, журналы убийств работают не так. Для эффективной дезинфекции вам нужен продукт, который безопасно и эффективно убивает 99,999% вирусов и бактерий.

Последний совет после внимательного прочтения паспорта безопасности Force of Nature. Использовать нужно в хорошо проветриваемом помещении. Несовместим с аммиаком и другими кислотами. И, по нашему опыту, хлорноватистая кислота разлагается на хлор, который может оказывать коррозионное воздействие на некоторые материалы.Перед использованием протестируйте средство на незаметном участке.

 

Graco 3A2497Bpro Xp 60 Aa Wb и Wb3000 Руководство пользователя 3A2497B, Инструкции, детали для электростатического пневматического распылителя Pro, изоляция, приложение

материал и качество изготовления на дату продажи первоначальному покупателю для использования. За исключением

любой специальной, расширенной или ограниченной гарантии, опубликованной Graco, Graco в течение двенадцати месяцев с даты

продажи отремонтирует или заменит любую часть оборудования, признанную Graco дефектной.Тем не менее, любой дефект

ствола, рукоятки, спускового крючка, крюка, внутреннего источника питания и генератора переменного тока (за исключением подшипников турбины) будет отремонтирован или заменен

в течение тридцати шести месяцев с даты продажи. Настоящая гарантия действительна только в том случае, если оборудование установлено, эксплуатируется

и обслуживается в соответствии с письменными рекомендациями Graco.

Настоящая гарантия не распространяется, и Graco не несет ответственности за общий износ или любую неисправность, повреждение или

износ, вызванные неправильной установкой, неправильным применением, истиранием, коррозией, неадекватным или неправильным обслуживанием, небрежностью,

несчастным случаем , подделка или замена компонентов, произведенных не компанией Graco.Graco также не несет ответственности за неисправность, повреждение

или износ, вызванные несовместимостью оборудования Graco с конструкциями, аксессуарами, оборудованием или материалами, не поставленными Graco

, или неправильным проектированием, изготовлением, установкой, эксплуатацией или обслуживанием конструкций, аксессуары,

оборудование или материалы, не поставляемые Graco.

Настоящая гарантия действует при предварительно оплаченном возврате оборудования, признанного дефектным, авторизованному дистрибьютору Graco

для проверки заявленного дефекта.Если заявленный дефект подтвердится, Graco бесплатно отремонтирует или заменит

любые дефектные детали. Оборудование будет возвращено первоначальному покупателю с предоплатой транспортировки. Если осмотр оборудования

не выявит каких-либо дефектов материала или изготовления, ремонт будет произведен за разумную плату, которая может включать стоимость запчастей, труда и транспортировки.

НАСТОЯЩАЯ ГАРАНТИЯ ЯВЛЯЕТСЯ ИСКЛЮЧИТЕЛЬНОЙ И ЗАМЕНЯЕТ ЛЮБЫЕ ДРУГИЕ ГАРАНТИИ, ЯВНЫЕ ИЛИ ПОДРАЗУМЕВАЕМЫЕ,

ВКЛЮЧАЯ, ПОМИМО ПРОЧЕГО, ГАРАНТИЮ КОММЕРЧЕСКОЙ ПРИГОДНОСТИ ИЛИ ГАРАНТИЮ ПРИГОДНОСТИ ДЛЯ КОНКРЕТНОЙ ЦЕЛИ.

Единственным обязательством Graco и единственным средством правовой защиты покупателя в случае любого нарушения гарантии является изложенное выше.

Покупатель соглашается с тем, что никакие другие средства правовой защиты (включая, помимо прочего, случайные или косвенные убытки в связи с упущенной выгодой, упущенными продажами,

травмы лица или имущества или любые другие случайные или косвенные убытки) не будут доступны. Любые иски о нарушении гарантии

должны быть поданы в течение двух (2) лет с даты продажи.

КОМПАНИЯ GRACO НЕ ДАЕТ НИКАКИХ ГАРАНТИЙ И ОТКАЗЫВАЕТСЯ ОТ ВСЕХ ПОДРАЗУМЕВАЕМЫХ ГАРАНТИЙ КОММЕРЧЕСКОЙ ПРИГОДНОСТИ И

ПРИГОДНОСТИ ДЛЯ ОПРЕДЕЛЕННОЙ ЦЕЛИ В СВЯЗИ С ПРИНАДЛЕЖНОСТЯМИ, ОБОРУДОВАНИЕМ, МАТЕРИАЛАМИ ИЛИ

КОМПОНЕНТАМИ, ПРОДАВАЕМЫМИ, НО НЕ ПРОИЗВОДИМЫМИ.На эти изделия, проданные, но не произведенные компанией Graco

(например, электродвигатели, переключатели, шланги и т. д.), распространяется гарантия производителя, если таковая имеется. Graco предоставит

покупателю разумную помощь в предъявлении любых требований о нарушении этих гарантий.

Ни при каких обстоятельствах Graco не несет ответственности за непрямой, случайный, фактический или последующий ущерб, возникший в результате поставки Graco оборудования

по настоящему Соглашению или поставки, работы или использования любых продуктов или других товаров, проданных ей, будь то из-за

нарушение контракта, нарушение гарантии, небрежность со стороны Graco или иное.

ДЛЯ КЛИЕНТОВ GRACO CANADA

Стороны признают, что они потребовали, чтобы настоящий документ, а также все документы, уведомления и судебные

судебные разбирательства, начатые или начатые в соответствии с настоящим или прямо или косвенно связанные с ним, были составлены в

англ. Les party reconnaissent avoir convenu que la rédaction du précente document sera en Anglais, ainsi que

tous документы, avis et procédures judiciaires exécutés, donnés ou намерения, à la suite de ou en rapport, directement ou

косвенные вопросы .

Информация Graco

Для получения последней информации о продуктах Graco посетите сайт www.graco.com. Информацию о патентах см. на веб-сайте www.graco.com/patents.

Чтобы разместить заказ, обратитесь к своему дистрибьютору Graco или позвоните по телефону, чтобы определить ближайшего дистрибьютора.

Телефон: 612-623-6921 или бесплатный номер: 1-800-328-0211 Факс: 612-378-3505

Все письменные и визуальные данные, содержащиеся в этом документе, отражают самую последнюю информацию о продукте, доступную на момент публикации.

Компания Graco оставляет за собой право вносить изменения в любое время без предварительного уведомления.

Оригинал инструкции. Это руководство содержит английский язык, MM 3A2497

Штаб-квартира Graco: Миннеаполис

Международные офисы: Бельгия, Китай, Япония, Корея

GRACO INC. И ДОЧЕРНИЕ ПРЕДПРИЯТИЯ • P.O. ВСТАВКА 1441 • МИННЕАПОЛИС, Миннесота 55440-1441 • США

Авторские права Graco Inc., 2012 г. Все производственные предприятия Graco зарегистрированы в соответствии со стандартом ISO 9001.

www.graco.com

Пересмотрено в июле 2013 г. Бесплатный полнотекстовый | Местный спрей дцРНК вызывает смертность и ингибирует передачу вируса курчавости листьев чили Bemisia tabaci Asia II 1

1.Введение

Белокрылка серебристолистная [Bemisia tabaci (Gennadius), Hemiptera: Aleyrodidae] представляет собой полужесткокрылое насекомое, питающееся флоэмой, которое, как сообщается, поражает более 600 видов растений во всем мире [1,2,3]. B. tabaci считается комплексом, состоящим как минимум из 46 морфологически неразличимых криптических видов [4,5,6]. Взрослые особи B. tabaci имеют длину около 1 мм с небольшими телами треугольной формы. Тело желтоватое с отчетливыми гиалиновыми крыльями, покрытыми белым порошкообразным воском. Взрослых особей B. tabaci можно отличить от других белокрылок по положению крыльев над телом.Крылья у B. tabaci плотно прилегают к телу и напоминают шатер. Он высасывает флоэмный сок, оставляя пораженные растения крайне слабыми, и выделяет на поверхность листьев медвяную росу, которая способствует росту сажистого плесневого гриба [7]. Помимо прямого повреждения, вызванного кормлением, B. tabaci переносит более сотни бегомовирусов, карлавирусов, кринивирусов, циторабдовирусов, ипомовирусов, полеровирусов и торрадовирусов ([8,9,10,11,12,13,14,15,16]. Среди них бегомовирусы составляют 90% вирусов, переносимых B.табак. Виды бегомовирусов получили широкое распространение в Центральной Америке, Доминиканской Республике, Израиле, Мексике, Тринидаде и по всей Юго-Восточной Азии, включая Камбоджу, Индонезию, Индию и Таиланд [17]. По оценкам, эти вирусы могут вызывать потерю урожая томатов и других культур на 50–90 %, включая фасоль, маниоку, перец чили, хлопок, тыквенные, баклажаны, папайю и картофель [18, 19]. Чили (Capsicum annum L., семейство Solanaceae) — одна из экономически важных сельскохозяйственных культур, выращиваемых в тропических и субтропических странах [20].Вирус курчавости листьев чили (ChiLCV, род Begomovirus, семейство Geminiviridae) является основным препятствием для производства перца чили, вызывая ежегодные потери около 15 миллиардов долларов США [21]. ChiLCV представляет собой однокомпонентный бегомовирус, который содержит один кольцевой одноцепочечный компонент ДНК-А размером 2,7 т.п.н. ChiLCV передается B. tabaci персистентно-циркуляторным путем. Виды стручкового перца. являются первичными хозяевами ChiLCV, но он также поражает помидоры и амарант [22,23]. ChiLCV стал причиной нескольких эпидемий в Индии и Шри-Ланке [24,25].Болезнь обычно проявляется у зараженных растений в виде скручивания вверх, сморщивания, скручивания листьев, образования пузырей на межжилковых участках, утолщения и вздутия жилок, укорочения междоузлий и черешков и задержки роста всего растения. Листья становятся меньше, а сильно пораженные растения дают меньше и деформированные плоды. У чили зафиксированы потери урожая на 20–50 % [26], которые могут возрасти до 100 % в случае одновременного заражения трипсами и клещами [27]. Варианты управления для ChiLCV и B.tabaci очень ограничены, поскольку инсектициды продолжают терять свою эффективность из-за появления устойчивых к инсектицидам популяций B. tabaci. Кроме того, инсектициды негативно влияют на окружающую среду и здоровье человека. Учитывая продолжающееся отсутствие признания потребителей, технология трансгенных растений не является осуществимой стратегией. В последние годы РНК-интерференция (РНК-интерференция) показала себя многообещающей в борьбе с насекомыми-вредителями и вирусами растений. Двухцепочечная РНК (дцРНК) при попадании в клетку-хозяин подвергается процессингу ферментом Dicer и в ассоциации с РНК-индуцированным комплексом сайленсинга (RISC) расщепляет мРНК-мишень [28].Прерывание взаимосвязи между B. tabaci и бегомовирусом с помощью РНК-интерференции является многообещающим подходом. Для успешной персистентно-циркулирующей передачи частицам бегомовируса необходимо пересечь барьер средней кишки B. tabaci, чтобы циркулировать в гемолимфе и достичь первичных слюнных желез [29, 30]. Известно, что некоторые белки в средней кишке B. tabaci, такие как белки теплового шока (Hsp), циклофилины, белок распознавания пептидогликана и белок средней кишки, взаимодействуют с белком оболочки бегомовируса (CP) для успешной интернализации [31,32,33]. ,34].RNA-Seq B. tabaci в ответ на бегомовирусы выявил значительную активацию hsp70, фасциклина 2 (fas2) и некоторых других транскриптов [31,35]. При анализе сети регуляции генов эти гены были обогащены более высокими степенями взаимодействия. Такая же тенденция была зафиксирована в экспрессии мРНК в количественной ПЦР с обратной транскриптазой в реальном времени (RT-qPCR) после воздействия ChiLCV [35]. Хотя клеточные шапероны хозяина, такие как Hsp70, наряду с другими кошаперонами играют важную роль в нескольких клеточных процессах, иммунитете хозяина и реакциях на стресс [36], сообщалось, что hsp70 связан с передачей бегомовируса B.табак [31]. Ортологи молекулы адгезии нервных клеток (NCAM) в B. tabaci, подобные fas2, функционируют в синаптическом развитии и росте [37,38]. Кроме того, молекулы NCAM известны как рецепторы при репликации вируса [39]. Целью настоящего исследования является проверка функций hsp70 и fas2 B. tabaci в передаче ChiLCV с использованием РНКи и изучение возможности их использования в качестве новых генетических инструментов для борьбы с вредителями. Хотя для насекомых было определено несколько потенциальных мишеней РНКи, включая B .tabaci [40,41,42,43], большинство этих исследований проводились в контролируемых экспериментальных условиях, и их эффективность в полевых условиях ограничена. Быстрая деградация дцРНК во внеклеточной среде и отсутствие надежного метода доставки дцРНК ограничивают ее применимость в полевых условиях. Цель настоящего исследования состояла в том, чтобы индуцировать устойчивость против B. tabaci и ChiLCV путем распыления двухцепочечной РНК. В настоящем исследовании B. tabaci hsp70 и fas2 были подавлены, и сообщалось о результирующих эффектах на смертность и передачу вируса.Впервые в полуполевых условиях была продемонстрирована эффективность распыления голой дсРНК против полужесткокрылого насекомого. Результаты исследования обеспечивают новый, экологически безопасный вариант защиты от B. tabaci, а также от ChiLCV, который может снизить экономические потери, вызванные комплексом вирус-переносчик.

2. Материалы и методы

2.1. Популяция белокрылки
Гомогенная изосамка линии B. tabaci была получена от одной взрослой самки и содержалась на баклажанах (var.Navkiran, Mahyco) в Передовом центре вирусологии растений Индийского института сельскохозяйственных исследований (IARI), Нью-Дели, с 2015 года. Популяцию охарактеризовали путем секвенирования гена субъединицы I митохондриальной цитохромоксидазы (mtCOI) (таблица 1). Генотип или загадочный вид популяции B. tabaci был подтвержден на основе филогении байесовского вывода с учетом порога генетического расхождения в 4%, как описано Rehman et al. [6]. Популяцию содержали в контролируемых условиях окружающей среды при 28 ± 2 ° C, относительной влажности 60 ± 10% и фотопериоде 16 часов света и 8 часов темноты.
2.2. Вирусная культура
Инокулят ChiLCV был собран из чистой культуры, хранящейся в Передовом центре вирусологии растений, IARI, Нью-Дели, Индия. ChiLCV поддерживали в чили (разновидность Preeti, Nunhems) путем инокуляции B. tabaci в защищенных от насекомых условиях. Идентичность вируса была дополнительно подтверждена путем амплификации компонента ДНК-А в ПЦР с парами праймеров Begomo F и Begomo R [44] (таблица 1) и секвенированием.
2.3. Дизайн и синтез дцРНК

Для отбора фрагментов дцРНК полные последовательности генов B.tabaci hsp70 (номер доступа HM367079, HM013712, EU934240, HM013709) и fas2 (номер доступа XM_019049173) загружали из NCBI. Консервативные последовательности генов hsp70 и fas2 анализировали в программе siRNA Wizard 3.1, Invivogen. Сегменты, демонстрирующие потенциальные участки, образующие миРНК, тестировали на перекрестную реактивность с другими организмами, такими как Homo sapiens (хромосомы, неразмещенные и нелокализованные каркасы), Mus musculus (хромосомы, неразмещенные и нелокализованные каркасы), Aves (taxid:8782), Lepidoptera (taxid:8782). :7088), перепончатокрылые (taxid:7399), Formicidae (taxid:36668) и растения (taxid:3193) в NCBI с использованием анализа BLAST.Наконец, для синтеза дцРНК была выбрана область, специфичная для B. tabaci, не имеющая перекрестной реактивности с другими организмами.

Праймеры, нацеленные на сегмент двухцепочечной РНК, были разработаны в праймерном бласте NCBI (https://www.ncbi.nlm.nih.gov/tools/primer-blast/ (по состоянию на 4 июня 2021 г.) (таблица 1). Праймеры AG137F-AG138R (для hsp70) и AG283F-AG284R (для fas2) валидировали в градиентной ПЦР. Участки дцРНК амплифицировали из ДНК изосамок B. tabaci Asia II 1 в ПЦР с начальной денатурацией при 94 °C в течение 5 мин, 30 циклов из 94 ° C в течение 30 с, 56 ° C в течение 30 с и 72 ° C в течение 30 с и заключительный этап расширения при 72 ° C в течение 10 мин.Продукты ПЦР клонировали в плазмидный вектор L4440 между двумя промоторами Т7. Рекомбинантные плазмиды трансформировали в клетки Escherichia coli HT115, мутантные по РНКазе III. Тотальную РНК из рекомбинантных клеток E. coli HT115 экстрагировали с использованием реагента Trizol (Invitrogen, CA, USA) в соответствии с протоколом производителя, а дцРНК очищали в соответствии с Ahn et al. [45] с изменениями. Вкратце, рекомбинантные клетки E. coli HT115 инкубировали в течение 12 часов при непрерывном встряхивании при 37 ° C с последующей индукцией промотора T7 с помощью 1M изопропил-β-D-1-тиогалактопиранозида (IPTG).Бактериальные клетки собирали в микроцентрифужную пробирку объемом 1,5 мл путем центрифугирования при 10000×g в течение 5 мин и ресуспендировали в 1 мл тризола. Суспензию клеток перемешивали встряхиванием и выдерживали при комнатной температуре в течение 5 мин. Суспензию клеток смешивали с 200 мкл хлороформа, взбалтывали в течение 10 мин при 4°С. Верхнюю прозрачную водную фазу переносили в свежую пробирку и добавляли 0,8 объема охлажденного льдом изопропанола. Раствор тщательно перемешивали и инкубировали при 4°С в течение 10 мин. Смесь снова центрифугировали при 16 000×g в течение 10 мин при 4°C и отбрасывали надосадочную жидкость.Осадок промывали 70% этанолом, сушили на воздухе и ресуспендировали в 30 мкл воды, свободной от нуклеаз. Тотальную РНК, выделенную из рекомбинантных клеток E. coli HT115, смешивали с 1X красителем для загрузки РНК (Thermo Fisher Scientific, Массачусетс, США), нагревали при 70 °C в течение 5 минут и визуализировали на 2% агарозном геле, окрашенном с помощью GoodView (BR Biochem, Нью-Дели, Индия). Затем общую РНК обрабатывали 1 единицей ДНКазы I без РНКазы (Thermo Fisher Scientific) и 1 единицей РНКазы A, без ДНКазы и протеазы (Thermo Fisher Scientific) в присутствии 500 мМ хлорида натрия и инкубировали. в течение 1 часа при 37 ° C для устранения примесей ДНК и одноцепочечной РНК.Ферменты инактивировали экстракцией хлороформом, а оставшуюся дцРНК ресуспендировали в воде, свободной от нуклеаз. Очищенную дцРНК количественно определяли на спектрофотометре (NanoDrop 2000, Thermo Fisher Scientific), а целостность специфической дцРНК подтверждали на 2% нативном агарозном геле, окрашенном с помощью GoodView и визуализировавшем в системе документирования геля (Maestrogen, Xiangshan District, Тайвань). .

Таблица 1. Праймеры, использованные в исследовании.

Таблица 1. Праймеры, использованные в исследовании.

TCCAATGCACTAATCTGCCATATTA дцРНК синтеза Данное исследование
Грунтовка Название Primer Sequence (5′-3 ‘) Размер ампликана Размер отжига в ПЦР / в реальном времени PCR Усиливалась область Цель Ссылка
J-2195 TTGATTTTTTGGTCATCCAGAAGT 860 п.н. 53 ° С В. tabaci mtCOI Обнаружение B. tabaci загадочные виды [46]
L2-N-3014
Begomo F ACGCGTGCCGTGCTGCTGCCCCCATTGTCC 2.7 кб 57 ° С Begomovirus ДНК-А Обнаружение begomovirus [44]
Begomo R ACGCGTATGGGCTGYCGAAGTTSAGAC
AG137F TCAAAGAACATTTTTGTGCTACT 128 п.н. 56 ° С B. tabaci Hsp70 дцРНК Это исследование
AG138R GACCATTGTCTAGGTCTTCATTT
AG283F CTGGTGTTTTGACAATCGAC 150 п.н. 56 ° С В.tabaci fas2 дцРНК дцРНК синтез и РТ-КПЦР
AG284R TGATTATGCCTTCTTCCGTC
AG177F ACATGGAAAAGATCTGGCAT 121 п.н. 56 ° С В. tabaci β-актина RT-QPCR Это исследование
AG178R TGAGTCATCTTTTCACGGGTT
AG204F GTCAATGATTGCAGTAAGCCCC 105 BP 56 ° C B.tabaci HSP70 RT-КПЦР Данное исследование
AG205R TTCCCTCATTTTCGTAAGCA
AG149F TGAACAGGCCCATGAACAG 290 п.н. 53 ° С ChiLCV белка оболочки КПЦР и ChiLCV Обнаружение [ 47]
AG150R ACGGACAAGGAAAAACATCAC
2.4. Биоанализ дцРНК при искусственном вскармливании в контролируемых условиях
Очищенные дцРНК hsp70 и fas2 были индивидуально и перорально доставлены B.tabaci взрослых по методу Upadhyay et al. [40] с изменениями. Вкратце, искусственную диету готовили путем смешивания 20% сахарозы и 5% дрожжевого экстракта в стерильной дистиллированной воде и автоклавирования. Искусственная диета была дополнена 1,0, 2,0 и 3,0 мкг/мл дцРНК и помещена между двумя слоями стерилизованных УФ-излучением растянутых мембран Parafilm M на открытом горлышке 15-мл цилиндрической бутылки для домашних животных (3,5 см в диаметре и 16 см в высоту). . В стенке бутылки было сделано отверстие и закрыто муслиновой тканью для вентиляции.Партию из 30 взрослых особей B. tabaci помещали в каждую бутылку для кормления дцРНК, смешанной с искусственной пищей, в течение 24 часов. Контролем служила стерильная дистиллированная вода вместо дцРНК. После 24 часов кормления рассчитывали процент смертности и сравнивали с необработанным контролем. Выдерживали три повторения для каждой концентрации и повторяли дважды. Среднюю смертность при каждом лечении корректировали путем нормализации смертности в контрольной выборке. Средние различия между категориями были разделены тестом Тьюки с доверительным интервалом 95% с использованием XLSTAT 2014.5.03. Выжившие B. tabaci из нескольких таких повторов использовали для определения относительной экспрессии мРНК hsp70 и fas2 и оценки эффективности приобретения и передачи ChiLCV после кормления дцРНК, как описано ниже.
2.5. Оценка относительной экспрессии мРНК hsp70 и fas2
Относительную экспрессию мРНК hsp70 B. tabaci после воздействия дцРНК оценивали с помощью анализа RT-qPCR по методу 2 -ΔΔC T [48]. Ген β-актина служил эндогенным контролем.Пары праймеров (AG204F-AG205R для hsp70; AG283F-AG284R для fas2 и AG177F-AG178R для β-актина), использованные в RT-qPCR, перечислены в таблице 1. и 3,0 мкг/мл, как описано выше, выжившие B. tabaci собирали после каждой обработки отдельно. Около 30 выживших B. tabaci в 3-х повторностях использовали для каждой из обработок и доз для оценки относительной экспрессии генов-мишеней. Взрослые особи B. tabaci измельчали ​​в 1 мл реагента Trizol в микроцентрифужных пробирках с использованием ручного автоматизатора.Тотальную РНК выделяли, как описано ранее. Суммарную РНК количественно определяли на спектрофотометре (NanoDrop 2000, Thermo Fisher Scientific), а комплементарную ДНК синтезировали с использованием набора для синтеза кДНК FIREScript RT (Solis BioDyne, Tartu, Эстония) с 1,0 мкг матричной РНК для каждого набора. Реакционная смесь содержала реакционный буфер 1X RT, 1,0 мкг матричной РНК, 5,0 мкМ олиго-dT-праймера, 500 мкМ смеси dNTP, 10 единиц FIREScript RT и 1 единицу ингибитора РНКазы RiboGrip. Обратную транскрипцию проводили в термоциклере (T100, Bio-Rad, CA, USA) при 42°С в течение 60 мин с последующей инактивацией фермента при 85°С в течение 5 мин.Относительный анализ RT-qPCR проводили в ПЦР в реальном времени Insta Q48M (Himedia, Mumbai, India) с 20 мкл реакционной смеси, содержащей 10 мкл 1X Maxima SYBR green master mix, 10 мкМ пассивного эталонного красителя ROX, 10 пмоль каждого прямой и обратный праймеры (AG204F-AG205R для hsp70; AG283F-AG284R для fas2 и AG177F-AG178R для β-актина) и 2 мкл матричной кДНК. Термическое циклирование выполняли в виде начальной денатурации при 94 °С в течение 5 мин, 30 циклов при 94 °С в течение 30 с, 56 °С в течение 30 с и 72 °С в течение 30 с.Поскольку краситель SYBR Green I неспецифически связывается с любой двухцепочечной ДНК, после каждой реакции проводили стадию диссоциации или плавления для определения специфичности ампликонов на основе кривой плавления. RT-qPCR проводили с тремя биологическими и двумя техническими повторностями. Кратность изменения экспрессии была нормализована путем исключения изменений значения порога цикла (C T ) эндогенного контроля, β-актина. Рассчитывали значение кратного изменения Log 2 и относительную экспрессию мРНК определяли путем нормализации значений log 2 2 -ΔΔC T обработанных дцРНК образцов с необработанным контролем [48].Статистический анализ и подготовка графиков проводились в Microsoft Excel 2016.
2.6. Количественная оценка копий вируса в B. tabaci и передача ChiLCV

Часть B. tabaci, которая выжила после введения дцРНК в дозах 1,0, 2,0 и 3,0 мкг/мл, как описано выше, позволяла питаться растениями перца чили, инфицированными ChiLCV. (вар. Прити) на 24 ч. Около 50 выживших B. tabaci в 3 повторах использовали для каждой обработки и дозы. Копии ChiLCV, полученные через 24 часа после кормления экспонированными дцРНК штаммами B.tabaci оценивали абсолютным количественным определением в количественной ПЦР. Стандартную кривую ChiLCV получали с использованием клона частичного гена CP ChiLCV в векторе pJET1.0 (Thermo Fisher Scientific). Затем 10-кратные серийные разведения (от 5 × 10 2 до 5 × 10 -5 нг) линеаризованной плазмиды амплифицировали в количественной ПЦР, как описано ниже. Стандартную кривую получали путем построения кривой линейной регрессии с log 10 разведений ДНК на оси X и значениями C T на оси Y.Для построения стандартной кривой использовали три повторения каждого разведения. Статистический анализ и построение графиков проводили в Microsoft Excel 2016.

Через 24 ч сбора ДНК выделяли с использованием экстракционного буфера CTAB [49] из B. tabaci (30 в повторности), подвергшихся воздействию различных доз (1,0, 2,0, и 3,0 мкг/мл) дцРНК hsp70 и fas2 отдельно. Вкратце, взрослые особи B. tabaci измельчали ​​в 1 мл буфера для экстракции СТАВ (2% СТАВ, 100 мМ Трис-HCl, рН 8,0, 20 мМ ЭДТА, рН 8,0, 1,0).4 М NaCl и 2 мкл β-меркаптоэтанола). Гомогенат нагревали на сухой бане при 65 °С в течение 30 мин и добавляли к нему равный объем смеси хлороформ-изоамиловый спирт (24:1). Смесь встряхивали при g в течение 15 мин. Верхнюю водную фазу переносили в свежую микроцентрифужную пробирку и добавляли равный объем изопропанола для осаждения ДНК. Затем раствор центрифугировали при 16000×g в течение 15 минут для осаждения ДНК и промывали 70% этанолом. Осадок высушивали на воздухе и растворяли в 30 мкл стерильной дистиллированной воды с последующей количественной ПЦР с ChiLCV-специфичными праймерами AG149F и AG150R [47] (табл. 1).qPCR проводили в ПЦР в реальном времени Insta Q48M с 20 мкл реакционной смеси, как описано выше. Термическое циклирование выполняли в виде начальной денатурации при 94 °С в течение 5 мин, 30 циклов при 94 °С в течение 30 с, 53 °С в течение 30 с и 72 °С в течение 30 с. Анализ кривой плавления проводили после каждой реакции для проверки специфичности ампликонов. Каждая обработка состояла из трех биологических и двух технических повторностей. Средние значения C T , полученные в количественной ПЦР, были помещены на стандартную кривую, а полученная концентрация использовалась для расчета числа копий вируса в Microsoft Excel 2016 по следующей формуле. .Средние различия среди средних копий вируса были разделены критерием Тьюки с доверительным интервалом 95% с использованием XLSTAT 2014.5.03.

Номер копии вируса N=x×6,022×1023n×660×109

где N = количество копий вируса, x = количество ампликона в нг и n = длина линеаризованной плазмидной ДНК.

В эксперименте по передаче ChiLCV B. tabaci, пережившие воздействие различных доз (1,0, 2,0 и 3,0 мкг/мл) hsp70 и дцРНК fas2, давали питаться растениями чили, инфицированными ChiLCV, в течение 24 часов.После подкормки для приобретения их выпускали на здоровые растения чили (сорт Preeti) на стадии 4–6 листьев в течение 24 ч подкормки инокуляцией, а затем уничтожали. Выпускали по две взрослых самки на растение. Все растения содержались в защищенных от насекомых условиях и контролировались на предмет развития симптомов. Инфекцию ChiLCV в инокулированных растениях подтверждали с помощью ПЦР через 35 дней после инокуляции. Эффективность передачи рассчитывали как процент растений, инфицированных ChiLCV после 24-часовой инокуляции подкормкой B.табак. B. tabaci без какого-либо воздействия дцРНК использовали в качестве контроля. Для каждой обработки использовали три биологические повторности, и каждая повторность содержала пять растений. Тест Тьюки использовался для проверки значительных различий в эффективности передачи. значения p менее 0,05 считались статистически значимыми.

2.7. Местный спрей дцРНК hsp70 в закрытых полуполевых условиях

Доза дцРНК (30 мкг/мл) в 10 раз выше, чем в контролируемых условиях, для проверки ее эффективности в замкнутом эксперименте в полуполевых условиях, где растения находились накрывают сеткой от насекомых и хранят на открытом воздухе.ДцРНК не вводили искусственно и не наносили непосредственно на B. tabaci. Вместо этого обнаженную дцРНК hsp70 распыляли местно на зараженные ChiLCV растения чили (разновидность Preeti) в качестве инсектицида в защищенном от насекомых сетчатом домике. В качестве контроля опрыскивали стерильной дистиллированной водой. Растениям давали высохнуть на воздухе, и 100 взрослых особей B. tabaci, свободных от вирусов, высвобождали на каждое обработанное дцРНК растение, инфицированное ChiLCV, через 24 часа опрыскивания дцРНК. Всего сохраняли 3 биологические повторности, по 10 растений в каждой.Процент смертности B. tabaci через 24 часа после высвобождения на растения, обработанные дцРНК, рассчитывали путем нормализации средней смертности в контрольной группе. Около 30 выживших B. tabaci в 3 повторах использовали для определения уровней мРНК hsp70 в RT-qPCR, как описано выше. Другая часть выживших B. tabaci использовалась для передачи ChiLCV и была выпущена на здоровые растения чили на стадии 4–6 листьев (5 взрослых особей на растение) в течение 24 часов после инокуляционного питания. Все растения содержались в защищенных от насекомых условиях и тестировались методом ПЦР на инфицирование ChiLCV через 35 дней после инокуляции.Всего использовали 5 биологических повторов, содержащих по 12 растений в каждом, и эффективность передачи рассчитывали как процент растений, инфицированных ChiLCV. Тест Тьюки был проведен для определения значительных различий в средней смертности и эффективности передачи среди категорий при доверительном интервале 95%.

2.8. Стабильность дцРНК hsp70 в тканях листьев

Для оценки стабильности дцРНК на растениях, опрыскиваемых местно, апикальную ткань листьев собирали через 1, 3, 6, 24 и 48 ч после опрыскивания дцРНК в 3 повторностях.Контролем служили растения, опрыскиваемые стерильной дистиллированной водой. Суммарную РНК выделяли из 100 мг растительных тканей с использованием реагента Тризол, как описано выше. кДНК синтезировали с использованием праймера, специфичного для дцРНК hsp70 (AG137F и AG138R), и присутствие дцРНК hsp70 проверяли с помощью ПЦР, как описано выше. Эксперимент повторили дважды.

2.9. Стойкая эффективность дцРНК hsp70 для искоренения B. tabaci

Стойкость эрадикации популяции B. tabaci путем местного распыления дцРНК hsp70 оценивали в замкнутом эксперименте в полуполевых условиях.Растения чили местно опрыскивали дцРНК hsp70 в концентрации 30 мкг/мл. B. tabaci высвобождались на растениях, обработанных дцРНК, после 24 ч опрыскивания дцРНК. Каждые 24 часа старых взрослых особей B. tabaci удаляли вручную, а свежих взрослых особей выпускали для проверки постоянства эффективности дцРНК. Каждый раз выпускали в общей сложности 30 взрослых особей на растение, и процент гибели регистрировали через 24 часа после каждого выпуска. Это продолжалось до тех пор, пока процент смертности не уменьшился значительно. При значительном снижении смертности после первого распыления было предпринято второе применение дцРНК.Процент смертности регистрировали с интервалом в 24 часа после второго опрыскивания, как описано выше. Вместо дцРНК в качестве необработанного контроля распыляли стерильную дистиллированную воду. Для расчета процента гибели использовали три биологических повтора, каждый из которых содержал пять растений.

4. Обсуждение

В мире было принято несколько стратегий борьбы с инсектицидами в качестве основного компонента борьбы с комплексом B. tabaci-ChilLCV. Однако использование химических инсектицидов привело к нескольким пагубным последствиям, таким как развитие устойчивых к инсектицидам штаммов B.tabaci, уничтожение полезных организмов, загрязнение окружающей среды и опасность для здоровья [50,51,52]. Существует потребность в альтернативном экологически безопасном подходе к управлению B. tabaci-ChiLCV. РНКи или посттранскрипционное замалчивание генов (PTGS) было введено для изучения функциональности специфических генов посредством нокдауна мРНК гена-мишени [53]. Однако вскоре он получил признание в качестве потенциального терапевтического средства для борьбы с насекомыми-вредителями [54,55]. Благодаря достижениям в технологиях секвенирования и транскриптомики следующего поколения несколько генов были идентифицированы как потенциальные мишени для контроля B.tabaci и его вирусы [33,34,35,36,37,38,39,40,56,57,58]. Однако большинство исследований ограничивается пероральным введением дцРНК B. tabaci посредством искусственной диеты или генетической модификации растений-хозяев [40, 43, 59, 60]. Ни одна из этих молекул РНК-интерференции не тестировалась на эффективность и не была признана эффективной в полевых условиях, что ограничивает их широкомасштабное внедрение. РНКи с использованием конструкций дцРНК не подходит для полевых условий из-за быстрой деградации и отсутствия надежных агентов доставки. В настоящем исследовании мы впервые продемонстрировали эффективность голой дцРНК против насекомых-вредителей путем распыления в полуполевых условиях.Конструкция дцРНК, нацеленная на ген hsp70 B. tabaci, не только вызывала смертность B. tabaci, но также ингибировала передачу ChiLCV от инфицированных к здоровым растениям чили с помощью B. tabaci. Было обнаружено, что Hsp70 и fas2 значительно активируются у вирулентных B. tabaci вместе с несколькими другими генами [30,35,57]. Регуляторные сети генов показали, что эти гены были обогащены более высокими степенями взаимодействия [35]. Транскрипты Hsp70 увеличивались при поглощении вируса желтой курчавости листьев томата (TYLCV) и вируса курчавости листьев тыквы (SLCV) в ДНК-микрочипе [31].Роль hsp70 в передаче бегомовируса хорошо изучена [30,31,57,60,61]. TYLCV CP и Hsp70 взаимодействовали in vitro и совместно локализовались в эпителиальных клетках средней кишки [30,31]. Уровень экспрессии мРНК fas2 повышался у вирулосодержащих B. tabaci в 2,6 и 4,518 раза в анализах RNA-Seq и RT-qPCR соответственно. Известно, что ортолог Fas2 у млекопитающих (NCAM) служит рецептором вируса бешенства [39]. Следовательно, мы стремились сбить эти два гена, hsp70 и fas2, чтобы вызвать иммунитет к инфекции ChiLCV у B.табак. Было обнаружено, что консервативные участки длиной 128 и 150 нуклеотидов в генах hsp70 и fas2, соответственно, специфичны для B. tabaci без какой-либо перекрестной реактивности с людьми, мышами, птицами, бабочками, пчелами, муравьями и растениями. Каждый продуцировал предполагаемую миРНК из 21 нт. dsRNA синтезировали путем транскрипции in vivo для получения больших количеств dsRNA по низкой цене. Бактериально экспрессируемая дцРНК экономична и удобна, как сообщалось в нескольких исследованиях [62, 63, 64]. Перед оценкой эффективности местного распыления дцРНК мы протестировали ее в контролируемых лабораторных условиях.ДцРНК hsp70 и fas2 перорально доставляли взрослым B. tabaci путем смешивания с искусственной диетой в установке для кормления. Сообщалось, что аналогичные типы искусственного питания эффективны при пероральной доставке дцРНК [40,41,42]. Значительный нокдаун популяции B. tabaci был зарегистрирован через 24 ч, который постепенно увеличивался с увеличением концентрации дцРНК. До 82,22% смертности B. tabaci было зарегистрировано после 24-часового кормления 3,0 мкг/мл дцРНК hsp70. Точно так же дцРНК fas2 в концентрации 3,0 мкг/мл вызывала 72% смертность B.tabaci через 24 часа после кормления. Воздействие дцРНК подавляло экспрессию мРНК hsp70 и fas2 в 12,85 и 8,53 раза соответственно. Экспрессия эндогенного контрольного гена не регулировалась после воздействия дцРНК. Это указывало на специфичность конструкций dsRNA к генам-мишеням. Hsp принадлежит к семейству многофункциональных молекулярных шаперонов, участвующих в агрегации поврежденных белков, транспортировке, сборке и разборке многоструктурных единиц в стрессовых условиях [36,65].Смертность B. tabaci после кормления дцРНК может быть связана с потерей функции из-за истощения мРНК hsp70, что может нарушить нормальные биологические процессы у B. tabaci. У Drosophila melanogaster Fas2 участвует в развитии и росте синапсов [37,38]. Также известно, что он функционирует во внутриклеточных сигнальных путях, которые включают митоген-активированную протеинкиназу (MAPK) и регулируют уровни внутриклеточного кальция [38]. Однако функция fas2 у B. tabaci не охарактеризована. Канакала и др.[60] сообщили о скручивании крыльев у B. tabaci при подавлении hsp70. Однако мы не зафиксировали каких-либо морфологических деформаций у обработанных B. tabaci. Hsp70 и fas2 могут не участвовать в морфогенезе B. tabaci, или для возникновения таких деформаций требуется более длительное воздействие dsRNA. Постоянная циркулирующая передача ChiLCV B. tabaci указывает на то, что вирусные частицы достигают средней кишки после приема внутрь. Вирионы преодолевают барьер средней кишки, циркулируют в гемолимфе и накапливаются в первичных слюнных железах [30].Hsp70, наряду с другими молекулярными шаперонами, играет важную роль в транслокации вирусных белков, помимо своей функции в вирусной репликации, сборке и разборке вирусных белков внутри хозяина [66,67,68,69,70]. Было обнаружено, что Hsp70 взаимодействует с TYLCV CP in vitro и совместно локализуется в эпителиальных клетках средней кишки [31]. В настоящем исследовании пероральная доставка дцРНК hsp70 значительно снижала количество копий ChiLCV в B. tabaci Asia II 1, а также его передачу здоровым растениям чили.Устойчивость к ChiLCV у B. tabaci усиливалась при более высоких концентрациях дцРНК hsp70. Копии ChiLCV у B. tabaci были незаметны, когда B. tabaci питались 3 мкг/мл дцРНК hsp70 в течение 24 часов. Передача ChiLCV от инфицированных к здоровым растениям с помощью B. tabaci Asia II 1 полностью ингибировалась при обработке дцРНК hsp70 3 мкг/мл в контролируемых условиях. Наши выводы согласуются с Kanakala et al. [60], которые сообщили о вредном влиянии дцРНК hsp70 B. tabaci на передачу TYLCV. Титр TYLCV снизился у B.tabaci Middle East Asia Minor 1 (MEAM 1) после кормления растениями томата, экспрессирующими дцРНК hsp70. Передача TYLCV также снизилась на 12% после подавления hsp70 [60]. В настоящем исследовании неспособность B. tabaci Asia II 1 удерживать и передавать ChiLCV после молчания hsp70 указывает на то, что он также может играть важную роль при инфекции ChiLCV. Однако Gotz и соавт. [31] сообщили об увеличении передачи TYLCV при блокировании Hsp70 антителом против Hsp70 в B. tabaci MEAM1. Было высказано предположение, что взаимодействие Hsp70-TYLCV опосредует деградацию вирионов.Снижение активности hsp70, hsp40 и hsp20 приводило к увеличению титра вируса курчавости листьев хлопка (CLCuV) в 3,1, 1,5 и 1,2 раза в B. tabaci. Значительно повышенная эффективность передачи CLCuV была отмечена у B. tabaci Asia II 1 при молчании hsp70 [61]. Различие может быть связано с различиями в видах вирусов и криптических видах B. tabaci. Взаимодействия B. tabaci с бегомовирусами не сохраняются и изменяются у криптических видов B. tabaci и бегомовирусов [71,72].B. tabaci MEAM1 имеет два гена (Bta03000 и Bta02903), аннотированные как hsp70, и их аминокислотные последовательности различаются на 97,55% [56]. Они также могут проявлять дифференциальную реакцию на бегомовирусную инфекцию. В отличие от обработки дцРНК hsp70, увеличение количества копий ChiLCV у B. tabaci было зарегистрировано после кормления дцРНК fas2. Известно, что ортолог Fas2 у млекопитающих (NCAM) служит рецептором вируса бешенства. Хотя NCAM способствует проникновению вируса в клетки, он подавляет репликацию вируса за счет индукции интерферона-ß [39], который в основном участвует во врожденном иммунитете против вирусной инфекции.Активация транскриптов fas2 у B. tabaci после инфицирования ChiLCV может быть связана с врожденным иммунным ответом на вирусную инфекцию [35]. Мы предположили, что fas2 играет негативную регуляторную роль в инфицировании ChiLCV, и, таким образом, нокдаун fas2 увеличивает титр вируса у B. tabaci. Следовательно, считалось, что подавление fas2 не индуцирует устойчивость к ChiLCV, несмотря на его эффективность в уничтожении B. tabaci. Хотя РНКи стала многообещающей альтернативой для подавления вредителей сельскохозяйственных культур [73,74], существуют ограничения в применении дцРНК в качестве технологии «распыления» для использования в полевых условиях.Сниженная стабильность дцРНК во внеклеточной среде способствует плохому ответу РНК-интерференции. Голая дцРНК быстро разлагается при более высоких температурах и УФ-излучении в естественных условиях окружающей среды. Кроме того, было обнаружено, что несколько видов насекомых, в основном чешуекрылые, невосприимчивы к РНКи из-за деградации и плохого внутриклеточного транспорта экзогенной дсРНК [75,76]. Нуклеазы являются основными факторами, ограничивающими эффективность дцРНК [75,76,77]. На первом этапе исследования дцРНК hsp70 продемонстрировала высокий потенциал эрадикации B.tabaci и ингибирование передачи ChiLCV. На следующем этапе конструкцию дцРНК оценивали в естественных условиях окружающей среды путем распыления, как инсектицида. Взрослые особи B. tabaci очень подвижны, поэтому опрыскивание взрослых мух нежелательно. Таким образом, голую дцРНК hsp70 без какого-либо агента доставки распыляли местно на листву растения чили, инфицированного ChiLCV, в замкнутых полуполевых условиях. Взрослые особи B. tabaci выпускали на растения, обработанные дцРНК, для оценки эффективности дцРНК в уничтожении B.tabaci и ингибирование передачи ChiLCV. Учитывая внеклеточную деградацию дцРНК и доставку через растение-хозяин, для местного применения использовали дозу, в 10 раз превышающую контролируемую. Гибель 67,77% с 4,6-кратным снижением уровня мРНК hsp70 у B. tabaci, подвергшихся воздействию растений, опрысканных дцРНК, была отмечена через 24 часа после выпуска. Кроме того, снижение количества копий ChiLCV в 1,84 × 10 8 и снижение передачи ChiLCV на 75% указывает на эффективность местного распыления дцРНК hsp70 в борьбе как с вирусом, так и с его вектором.Хотя эффективность местного применения голой dsRNA против растительных вирусов известна [78, 79, 80], это первое свидетельство ее эффективности против полужесткокрылых насекомых, таких как B. tabaci. Местное применение дцРНК может обеспечить устойчивость к вирусам растений в течение 12–21 дня [78,80,81,82]. В настоящем исследовании дцРНК была обнаружена в тканях листа в течение 6 часов после обработки. Значительная гибель B. tabaci на обработанных растениях сохранялась до 8 дней и в дальнейшем поддерживалась до 20 дней при втором опрыскивании на 10-й день.Защита растений на ранней стадии роста имеет решающее значение в борьбе с бегомовирусами. Заражение бегомовирусом на стадии 5 листьев у томатов снижало урожайность на 95% [83]. Заражение ChiLCV на стадии проростков приводит к значительному снижению высоты растений, длины междоузлий и плодоношения. Следовательно, 20-дневная защита с помощью 2 последовательных опрыскиваний голой дцРНК hsp70 защитит решающую фазу роста урожая от инвазии B. tabaci и ChiLCV и уменьшит потери урожая. Опрыскивание листвы дцРНК hsp70 было эффективным в полуполевых условиях, когда дневная температура колебалась в пределах 20–35 °C при относительной влажности 40–60%.

Добавить комментарий

Ваш адрес email не будет опубликован.