Лимфаденопатия мкб 10 код: Ошибка 404. Файл не найден

МКБ-10 код R59.1 | Генерализованное увеличение лимфатических узлов

ICD-10

ICD-10 is the 10th revision of the International Statistical Classification of Diseases and Related Health Problems (ICD), a medical classification list by the World Health Organization (WHO).

It contains codes for diseases, signs and symptoms, abnormal findings, complaints, social circumstances, and external causes of injury or diseases.

ATC

The Anatomical Therapeutic Chemical (ATC) Classification System is used for the classification of active ingredients of drugs according to the organ or system on which they act and their therapeutic, pharmacological and chemical properties.

It is controlled by the World Health Organization Collaborating Centre for Drug Statistics Methodology (WHOCC).

DDD

The defined daily dose (DDD) is a statistical measure of drug consumption, defined by the World Health Organization (WHO).

It is used to standardize the comparison of drug usage between different drugs or between different health care environments.

возможные причины появления, формы, методы диагностики и методы терапии

Зашифрованная как R59, I88, L04 в МКБ-10, лимфаденопатия у детей встречается относительно часто. Термином принято обозначать состояние, при котором лимфатический узел (или группа таковых) становится больше размерами. Причины явления могут быть самыми разными – от кариеса до тяжелого онкологического заболевания. Для определения этиологии требуется обследование организма, ряд специфических лабораторных и инструментальных исследований.

Актуальность вопроса

Известно немало случаев, когда увеличенные лимфатические узлы были первым сигналом тяжелого заболевания. К примеру, довольно редко, но встречается у детей лимфаденопатия, в МКБ-10 код которой – B23.1, то есть генерализованная патология, объясняющаяся ВИЧ. Состояние стойкое, указывающее на опасность для жизни. В других случаях рассматриваемая проблема может сигнализировать об иных тяжелых патологиях, включая злокачественные новообразования. Из медицинской статистики известно, что во внушительном проценте случаев определение факторов воспалительного процесса требует многочисленных лабораторных анализов.

Была введена система классификации всех случаев на группы. Ее отражают действующие правила присвоения кодов по МКБ-10. Лимфаденопатия у детей категоризируется, исходя из признаков случая. Оценивают тяжесть процесса и нюансы его прогресса, обилие и разнообразие проявлений.

О классификации

Оценивая распространенность патологического состояния, все случаи разделяют на локальные и генерализованные. Первое предполагает, что воспаление затронуло лишь отдельный лимфатический узел или ограниченную группу таковых. Возможно определение патологии как региональной. Существенно более тяжело протекает у взрослого и ребенка лимфаденопатия генерализованного типа. При локальном формате обычно процесс затрагивает только некоторую группу. Реактивная форма возможна как результат наличия в организме очага воспаления, инвазии инфекционного агента. Иногда патология объясняется аллергическим ответом или аутоиммунным процессом.

Известны такие случаи, когда при уточнении диагноза лимфаденопатию у детей, взрослых признают неясной, то есть этиологию установить не получается. В МКБ-10 для такой формы введен специальный шифр R59.9. Им кодируют все неуточненные случаи.

Оценивая состояние больного, можно понять, относится ли случай к опухолевым или таковым не является. Впрочем, нужно понимать: оба типа опасны для пациента.

Первичная диагностика

Исходя из признаков лимфаденопатии у детей уже первичный диагноз можно поставить достаточно точным. В первую очередь оценивают размер воспаленной области. Считается, что габариты лимфатических улов – основной критерий оценки. Нормальные размеры для разных узлов отличаются: это зависит от нюансов локализации, особенностей функционирования организма конкретного пациента. Обычно в здоровом теле лимфоузлы варьируются в границах 1-1,5 см в диаметре. Уже при пальпации области можно понять, насколько увеличены относительно нормы доступные для первичного обследования участки.

Еще один симптом, позволяющий заподозрить лимфаденопатию у ребенка – болезненность отдельных участков. Эти ощущения, как правило, сигнализируют о начале воспалительного процесса. Обследование зоны может показать наличие абсцесса, некротических процессов.

Изучая участки, следует оценить спаянность узлов. Ее обнаружение позволяет предположить опухоль либо туберкулез.

Симптоматика

Как и у взрослых, возможна у детей шейная лимфаденопатия, брюшная, мезентериальная, а также любой иной тип. Всего в организме человека есть около 600 лимфатических узлов, и в любом из них может начаться воспалительный процесс. Свободно прощупать можно паховую зону, подмышечную ямку, область под челюстью, а также некоторые другие участки. Именно их проверяют в первую очередь, подозревая лимфаденопатию. Нестандартные габариты, болезненные ощущения в лимфоузлах любой локализации – повод для обращения к доктору за помощью. Причину явления может определить только врач.

Не всегда патологическое состояние замечают при пальпации лимфоузлов. Нередки случаи, когда первичными признаками лимфаденопатии у детей (брюшной, шейной или другой) были потеря веса, кожные высыпания и постоянный жар. Возможна активная беспричинная работа потовых желез, особенно характерная периоду ночного отдыха. У некоторых больных инструментальные обследования показывают увеличение селезенки, печени.

Поскольку лимфаденопатия может сформироваться из-за огромного количества факторов, ее считают лишь маркером некоторой болезни. Следовательно, лечение назначают, определив первопричину явления.

Причины и последствия

Довольно часто встречающаяся причина лимфаденопатии у детей и взрослых – инфекционный процесс в отдельном узле или нескольких. Возможна бактериальная инвазия: туберкулез или бруцеллез. Иногда лимфаденопатия указывает на сифилис. В ряде случаев увеличение лимфатических узлов позволяет заметить заражение хламидиями, токсоплазмой, лямблией, цитомегаловирусом. В некоторых случаях причина – сывороточная болезнь, вызванная неудачно выбранным курсом медикаментозных средств.

Известны случаи, когда лимфаденопатия у ребенка, взрослого начиналась на фоне вирусных заболеваний, включая гепатит и ВИЧ. Привести к патологическому состоянию могут токсокароз, саркоидоз, гистоплазмоз, актиномикоз. Иногда причина – артрит ревматоидного характера, травма соединительной ткани или заболевание, поразившее такие структуры. Есть вероятность, что состояние объясняется опухолевым процессом.

Виды и формы: локации и зависимость

Как видно из медицинской статистики, причиной лимфаденопатии подчелюстных лимфоузлов у детей, взрослых нередко становится инфекционный процесс. Повышенная вероятность патологии объясняется близостью узлов к зоне проникновения инфекции в организм, то есть характер болезни – субклинический. Известно, что у детей такая форма лимфаденопатии встречается в разы чаще, нежели среди совершеннолетних. Есть теория, считающая лимфаденопатию нормой для детей.

Лишь немногим реже встречается паховая лимфаденопатия. Она свойственна больше детям и молодежи, среди пациентов старшего возраста распространена чуть меньше. В большинстве случаев объясняется инфекционными процессами в организме.

Причиной лимфаденопатии шейных лимфоузлов у детей может стать инфекционный процесс в полости рта, заражение слюнных желез. Нередко к такому осложнению приводят паротит, краснуха и иные инфекции, распространенные среди малышей. Возможно развитие патологии на фоне воспаления в гортани, липоматоза, опухания околоушной железы.

Локации и особенности

Известно, что лимфаденопатия шейных лимфоузлов у детей и взрослых встречается часто, причем максимально высока ее вероятность среди лиц до достижения совершеннолетнего возраста. Специального лечения она не требует, проходит самостоятельно, когда будет устранена причина, вызвавшая увеличение узлов.

Медиастинальная форма может сопровождать легочное воспаление, злокачественные процессы в этой области, туберкулез. Если установлена лимфаденопатия легких у ребенка, важно контролировать развитие процесса. Это позволяет своевременно оценить эффективность выбранной терапевтической программы, заменить ее на другую, если лимфаденопатия не регрессирует.

Забрюшинная форма позволяет заподозрить новообразование. Как правило, пациента в первую очередь проверяют на наличие лимфомы. Воспалительный процесс вблизи ушей может свидетельствовать о кератиконьюнктивите, аденовирусном заражении.

Грудь, средостение и подмышечная ямка

Одна из наиболее опасных форм лимфаденопатии у ребенка и взрослого – внутригрудная. Нередко она указывает на новообразование или распространение опухоли в пределах грудной клетки, формирование метастазов. Такой диагноз детям ставят редко, выше вероятность лимфаденопатии этого типа у лиц старше сорокалетнего возраста, тем не менее риски свойственны любому возрасту, включая молодежь. Лимфаденопатия брюшной полости у детей и взрослых также иногда объясняется новообразованиями, хотя в ряде случаев патологическое состояние указывает на воспалительные, инфекционные процессы.

Относительно часто наблюдается увеличение лимфатических узлов в средостении. Причину такого явления выявить не всегда просто, и немалый процент случаев неизвестной этиологии приходится именно на такую локализацию. Установлено, что лимфаденопатия возможна по причине новообразования в ЖКТ, легких. Есть вероятность, что лимфатический узел стал областью локализации атипичных клеток.

В подмышечной ямке лимфаденопатия чаще объясняется недавно полученной травмой или инфекционным заболеванием. Расположенные в этой области узлы довольно часто воспаляются, увеличиваются в размерах даже при несущественных проблемах.

Типы и формы: обратить внимание!

Крайне редко у детей, но относительно часто у женщин среднего возраста встречается аксиллярная лимфаденопатия. Этот диагноз ставят, если разрастание объясняется раковыми процессами в молочной железе.

Легочная лимфаденопатия – гораздо более распространенное в детском возрасте состояние. Его считают нормальным ответом организма на воспалительные процессы, острые вирусные заболевания, простуду. Лимфоидные ткани таким образом реагируют на раздражающие факторы. Объясняющаяся именно этой причиной лимфаденопатия у детей лечения не требует.

Еще одна возможная форма болезни – вторичная. Ей присуще полное отсутствие болезненных ощущений, что существенно усложняет диагностику. Наблюдается патология на фоне низкой активности иммунитета. В ряде случаев причина – медикаментозный курс, прием химических соединений.

Классификация: завершая рассмотрение

Лимфаденопатия брюшной полости у детей – патологическое состояние, которое может свидетельствовать о кишечном инфицировании. Иногда его причина – распространение опухолевого процесса, метастазирование из кишечного тракта; возможный фактор – лейкоз.

Ангиоиммунобластная лимфома – еще один возможный инициатор лимфаденопатии. Этот диагноз выделен относительно недавно, в настоящее время составлено его описание, но работы по изучению и уточнению болезни еще ведутся.

Персистирующая лимфаденопатия – это состояние, свойственное хроническим больным. Его отличительная особенность – симметричность областей локализации. Диагноз ставят, если не удается выявить болезни или химического, медикаментозного фактора, способного вызвать лимфаденопатию, при этом синдром наблюдается в течение продолжительного срока (месяцами). Такая форма может указывать на ВИЧ.

В любом из вариантов локализации, будь то шейная или брюшная, меза-гастральная лимфаденопатия, лимфоузлы у ребенка повышенного объема должны привлечь внимание родителей. Определить точную причину явления может только доктор, проведя исследования. Паниковать заранее не стоит, но и затягивать с походом в клинику нельзя.

Уточнение состояния

Постановка диагноза предполагает первичный комплексный осмотр пациента, исследование истории болезни. Назначают анализы крови: общий, на биохимию и онкологические маркеры. Проверяют больного на ВИЧ и заражение гепатитом. Вне зависимости от области локализации для уточнения причин лимфаденопатии у детей (шейной, брюшной, паховой и любой другой) могут назначить ультразвуковое исследование брюшной полости, рентген грудной клетки. Описываемое патологическое состояние – это симптом, указывающий на некоторую проблему, болезнь. Именно ее определение – главная задача доктора, формулирующего диагноз.

Мой ребенок здоров!

Действительно, из медицинской статистики известно, что затрагивающая подчелюстные, шейные лимфоузлы лимфаденопатия у детей иногда встречается на фоне практически полного здоровья. Даже если родители уверены в том, что никаких серьезных проблем у чада нет, при увеличении этих желез следует обратиться к специалисту. Основная задача лимфатических узлов – фильтровать биологические жидкости, очищая кровь от опасной микрофлоры и иных включений. Разрастание узла наблюдается, если здесь скапливается слишком много чужеродных объектов. Обилие бактерий, вирусов, микробов повышает риск воспалительного процесса.

Нередки и такие случаи, когда никакого специального исследования не назначается. К примеру, если реактивная лимфаденопатия у детей наблюдается при простуде или гриппе, врач ставит пациента на учет до полного выздоровления. К концу болезни лимфатические узлы должны самостоятельно прийти в норму. В ряде случаев требуется назначение дополнительного курса антибиотиков. Впрочем, специфические анализы (включая указанные выше) придется сдать, если картина заболевания позволяет заподозрить нетипичность причины.

Как видно из статистики, 95% случаев увеличения лимфатических узлов в детском возрасте объясняются простыми инфекциями.

Лечить или нет

Если инфекционный процесс запустить, не лечить первопричину болезни и не уделять внимание состоянию лимфатических узлов, высока вероятность развития осложнений. В детском возрасте чаще встречается подкожная инфекция. Как правило, при лимфаденопатии шейных лимфоузлов у детей лечение предполагает курс антимикробных препаратов. Если причиной увеличения узла стало вирусное заражение или злокачественное новообразование, антимикробная терапия покажет неэффективность. Как правило, уже на этапе постановки диагноза и выбора программы лечения врач определяет характер процесса, поэтому удается избежать приема неэффективных составов, но возможны исключительные случаи. В любом варианте недопустимо при лимфаденопатии назначать ребенку лечение самостоятельно, на свое усмотрение – можно навредить, не добившись никакого улучшения состояния.

Если анализы крови показали заражение опасными микробами, но курс антибиотиков не меняет состояние лимфатических узлов, при лимфаденопатии у детей (мезентериальная, средостения, брюшная) назначают биопсию опухшей области. Еще один вариант – удаление этой железы с последующим исследованием под микроскопом. Около 5 % случаев лимфаденопатии объясняются серьезными проблемами со здоровьем, включая онкологию. Выше вероятность выявления тяжелого заболевания, если лимфатические узлы увеличиваются и воспаляются часто, процесс распространяется по всему телу.

Препараты: есть ли негативные эффекты

Чаще всего при лимфаденопатии назначают курс антибактериальных средств. Хотя основной процент пациентов хорошо переносит такие медикаменты, некоторые побочные реакции возможны. Чаще всего они затрагивают работу желудочно-кишечного тракта, нарушается аппетит и стул, возможна тошнота или рвота. Относительно высока частота случаев аллергической реакции.

В крайне редких случаях ответ организма больного более серьезный. Чтобы минимизировать риски таких явлений, важно применять препараты только по согласованию с доктором, в указанных им дозах и с определенной частотой. Длительность программы применения – такая, как скажет врач. Как правило, симптоматика пропадает несколько раньше, но заканчивать на этом прием медикаментов нельзя, растет вероятность рецидива и развития суперинфекции.

Нюансы патологии

Лимфаденопатия у детей (мезентериальная, легочная, брюшная, паховая и иная) обычно длится неделю или несколько. При определенных диагнозах возможно увеличение узла, наблюдаемое годами. Такое явление не всегда указывает на серьезные проблемы со здоровьем, иногда причины совершенно безопасны, все объясняется индивидуальными особенностями функционирования организма. Для уточнения этого факта следует пройти комплексное обследование.

Сильное увеличение лимфатического узла, болезненность участка, кожные покраснения – симптомы осложнения лимфаденопатии. При таких проявлениях нужно попасть на прием к доктору как можно скорее.

Если ребенку рекомендован больничный по причине лимфаденопатии, специального контроля за лечением зачастую не требуется. Если причина установлена точно, явление объясняется простудой, гриппом или иными сходными факторами, ребенка выписывают, когда состояние стабилизируется, а лимфоузлы постепенно приходят в норму самостоятельно. Специальных средств и препаратов для этого принимать не требуется. Если лимфаденопатия становится причиной назначения антибактериального курса, по завершении такой программы придется обязательно прийти на прием для контроля результатов.

Лимфаденопатия: степень развития

Принято делить все случаи на локальные, региональные, системные. Статистика демонстрирует: чаще всего встречается локальная лимфаденопатия, на ее долю приходится около 75% всех случаев. Региональную форму устанавливают, если одновременно воспалены и увеличены несколько лимфатических узлов в одной области или смежных (не более двух). Если воспалительные процессы выявлены в разных участках тела, не пересекающихся друг с другом, говорят о системной форме, наиболее опасной для человека.

У некоторых больных лимфаденопатия проявляет себя формированием своеобразной шишки в больной области. Прикосновение и нажатие на этот участок сопровождается неприятными ощущениями. Визуально можно заметить красноватые участки – это важный стимул поскорее обратиться к доктору. Еще одна возможная форма болезни – висцеральная. При ней страдают расположенные глубоко в организме лимфатические узлы, поэтому диагностика представляет собой немалые сложности. Выявить болезнь можно в ходе лабораторных, инструментальных исследований.

Заподозрить лимфаденопатию позволяет склонность к отекам, внезапный жар и лихорадочное состояние. При острой форме есть риск трансформации инфекционного процесса во флегмону. Предупредить это осложнение может своевременное вскрытие участка в условиях стерильности. А вот хроническая лимфаденопатия зачастую себя вовсе не проявляет.

Специфика ситуации

В детстве человек подвержен лимфаденопатии из-за частых воспалительных, простудных болезней. У детей гораздо чаще, нежели у взрослых, бывает кариес, также способный спровоцировать воспаление лимфатических узлов. Нередки случаи тонзиллита в хронической форме. Кроме того, лимфаденопатия нередко сопровождает период после получения вакцины, восстановление после терапевтического курса. При этом симптоматики зачастую нет, реже можно услышать жалобы на горло, шею.

Приблизительно у каждого третьего младенца можно вручную нащупать лимфатические узлы, диаметр которых – 30 мм и больше. До года у большинства детей без труда можно выделить лимфоузлы на шее. При опухолевых процессах возможно разрастание этой области. В диаметре узел может достигнуть 4 см. Известны запущенные случаи еще большего разрастания. При этом область приобретает повышенную плотность и отзывается болью при касаниях.

Лимфаденопатию диагностируют, если на шее и в подмышечной ямке лимфатические узлы в размере – более сантиметра. Для паховой области нормой считается диаметр до 1,5 см. Остальные лимфоузлы при пальпации вовсе не должны прощупываться. Их выявление, отзывчивость на осмотр болью указывают на нездоровье ребенка.

Болезни и их проявления

Лимфаденопатия нередко провоцируется стафило-, стрептококками, ЦМВ, гепатитом и корью, токсоплазмой, гистоплазмой. Она может появиться на фоне кокцидиомикоза, заражения вирусом Эпштейна-Барра. Довольно характерная картина наблюдается при краснухе – воспалительный процесс охватывает лимфатические узлы в области затылка. Если ребенок болен туберкулезом, один из симптомов – опухание узлов в груди, иногда – шейных. Саркоидоз, волчанка, артрит, аллергическая реакция могут стать причиной лимфаденопатии. Последнее явление сопровождается проблемами с дыханием, кожными высыпаниями, отечностью.

Довольно часто встречающийся среди детей случай – так называемая болезнь кошачьей царапины. Это заболевание провоцирует бартонелла, переносимая кошачьими бактерия. Указывает на такую причину продолжительная незаживающая рана, нагноение этой области. Увеличивается расположенный ближе всего к ране лимфатический узел.

В целом гнойные процессы могут стать причиной лимфаденопатии в самых разных участках организма. Если область, наполненную гноем, не вскрыть вовремя в условиях больницы, произойдет разрыв, следовательно, гнойные выделения пропитают окружающие ткани. Такое осложнение называют флегмоной.

Особенный случай: младенцы

У новорожденных чаще встречается локальная форма. В большинстве случаев причина – местное инфицирование, нагноение участков кожных покровов. Генерализированная форма чаще наблюдается при аутоиммунных заболеваниях. Клинические проявления лимфаденопатии будут зависеть от первопричины. При генерализованной форме ребенку необходима неотложная помощь. При подозрении на эту патологию следует сразу обратиться в клинику.

Известно, что у грудничков лимфаденопатия наблюдается из-за инфекционного заражения или вирусного, накопительных заболеваний, аутоиммунных процессов. Возможные причины – новообразования, затронувшие костный мозг, кровеносную систему. Отличительная особенность состояния – исключительно быстрое распространение воспалительного процесса по всему организму ребенка. Как правило, на диагностику и выбор оптимального терапевтического курса есть совсем немного времени, поэтому важно своевременно обратиться к доктору, не теряя ни дня.

Заподозрить, что нужно обратиться к доктору если на шее ребенка прощупываются лимфатические узлы, диаметр которых сравним с горошиной или еще больше. Процесс может быть симметричным, но это не обязательно. Возможно изменение консистенции. В норме лимфоузлы мягкие и гладкие, податливые. При лимфаденопатии они приобретают плотность, становятся бугристыми, теряют подвижность.

Рак прямой кишки-симптомы и признаки, стадии

Рак прямой кишки – распространенное злокачественное заболевание, проявляющееся, как у мужчин, так и у женщин.

Поражение происходит в прямой кишке. Она располагается в полости малого таза, перед крестцом и копчиком. У мужчин перед ней находится начало мочеиспускательного канала, семенные пузырьки, предстательная железа и задняя стенка мочевого пузыря; у женщин – шейка матки и задний свод влагалища.

Прямая кишка анатомически делится на три отдела: надампульная часть, ампула и область заднепроходного канала. Длина кишки у среднестатистического человека примерно 12-18 см., диаметр её в среднем 3-4 см.

Факторы, вызывающие рак прямой кишки

Люди, достигшие возраста 50 лет, старея увеличивают шансы на риск возникновения рака прямой кишки.

Важным фактором в развитии онкологии является генетическая предрасположенность и наследственность. Изменение в генетическом наборе приводит к их мутации и возникновению раковых клеток во внутренних органах со всеми проявляющимися признаками.

Рак прямой кишки имеет развитие наиболее эффективно у людей с хроническими недугами ЖКТ.

Также активное распространение и возникновение новообразований в прямой кишке зависит от перенесенных ранее онкологических заболеваний. Так у женщин, перенесших онкологию молочной железы, риск метастазирования и возникновения вновь появившегося новообразования в кишке увеличивается.

Особенно важной причиной возникновения раковой опухоли в нижней части кишки является неправильное питание. Прием жирной, жареной пищи неблагоприятно влияет на организм, увеличивая риск заболевания.

Рак прямой кишки – стадии

Определение стадии рака прямой кишки происходит с обнаружением симптомов и признаков заболевания. Они имеют определенную классификацию, которая и позволяет определить стадийность заболевания.

1 стадия – наличие опухоли в организме без прорастания в стенки органа,

2 стадия – злокачественные клетки распространяются в стенки и ткани, но не метастазирует в ближайшие органы,

3 стадия – поражение лимфы и лимфатической системы,

4 стадия – обнаружение очагов в одном или нескольких отдаленных органов.

Рак прямой кишки – симптомы

Симптоматика злокачественного новообразования в прямой кишки зависит от ее нахождения, характера и роста. Самым важным признаком рака прямой кишки считается появление крови во время акта дефекации. С появлением крови возможно и присоединение гноя и слизи из-за сопутствующих инфекций и развития образований в других органах.

Рак прямой кишки распознается непроходящим нарушением стула – запоры, понос, вздутие живота. Изменение формы кала, цветности и структуры является признаком тревожного заболевания.

Нахождение опухоли в различных областях прямой кишки может характеризоваться болевым синдромом. Из-за отсутствия в аноректальной линии нервных окончаний боль проявляется только если новообразование достигло больших размеров и сдавливает органы, располагающиеся рядом, тогда симптомы становятся обманчивы и показаться уже при невозвратном уровне развития онкологии.

Симптомы ракового заболевания прямой кишки могут проявляться в общем состоянии человека повышенной усталостью, быстрое истощение тела, отсутствие аппетита и пальпация опухоли через брюшную полость.

Рак прямой кишки – диагностика

Диагностика лечения рака прямой кишки начинается с консультации врача. Выявление симптомов и назначение исследований помогает определить характер заболевания, его срок и степень развития.

Для подтверждения картины заболевания эффективным методом диагностики является исследование пальцами анального отверстия, у женщин и вагинального в том числе. Такое исследование способствует определить размеры новообразования врастание в стенки кишки и прилегающих органов в пределах 9 -10 см.

В процессе исследования кроме визуальной диагностики назначается цитология и биопсия биоматериала. Такое исследование позволяет оценить образность рака прямой кишки и назначить наиболее правильное лечение.

Назначение эндоскопических исследований позволяет понять метод распространения заболеваний, форму опухоли и ее размеры, а также стадию опухоли. Исследование с помощью рентгеновских лучей проходит с использованием ирригоскопии, которая позволяет выполнить контрастирование и установить дефект наполнения нижнего отдела кишки, сужение размера и другие признаки.

Ультразвуковые исследования брюшины и органов малого таза позволяют диагностировать уровень инвазии и распространения онкологических клеток в другие органы.

Исследования с использованием компьютерных технологий допускает оценку возможного метастазирования во внутренних органах.

Еще одно направление в выявлении первичных признаков рака прямой кишки – определение степени опухолевых маркеров. Повышение уровня ракового эмбрионального антигена говорит о злокачественных опухолях или других соматических недугах таких, как цирроз печени, гепатит, болезнь Крона и аутоиммунные заболевания.

Рак прямой кишки – лечение

К основным видам избавления от этого страшного недуга является комплекс или отдельное применение оперативного вмешательства, дозах лучевой терапии и приема лекарственных препаратов. Единственный радикальный метод лечения рака прямой кишки – это удаление.

Если диагностика показала возможность сохранения органа, то возможно применение лучевой терапии. Такой вид лечения помогает ограничить распространение заболевания, снижение рецидивов и общих симптомов рака прямой кишки.

Химиотерапевтическое лечение назначается обычно после операции отсечения для невозможности микро метастазирования, снятия признаков заболевания. Чаще всего такое лечение назначается при 3 стадии онкологического недуга.

Также возможно комплексное лечение, совмещающее все виды лечения данного заболевания. Перед операцией назначается лучевая терапия, затем производится оперативное вмешательство и лечение злокачественной опухоли лекарственными препаратами.

При эктомии участков прямой кишки, нарушаются функции других органов, что пагубно влияет на обычное течение жизни человека.

Усовершенствованные методы лечения рака прямой кишки позволяет использовать современные виды оперативного вмешательства:

  1. нервосберегающие операции, которые не удаляет нервные окончания, позволяющие сохранить признаки естественных ощущений наполняемости прилегающих органов и позывов их опустошения;
  2. сфинктеросохраняющие операции, которые способны сохранить естественное отхождение каловых масс не через искусственное отверстие в брюшной полости, а сохранение природного его состояния.

Далее назначается профилактическое лечение, которое помогает облегчить симптомы, снизить признаки заболевания и контролировать рост и развитие опухоли. Задачей наблюдения является отсутствие рецидивных опухолей и поддержание нормального уровня жизни пациента. У женщин, и у мужчин обязательно ведение половой жизни и сохранение репродуктивного здоровья.

Филиалы и отделения, в которых лечат рак прямой кишки

МНИОИ им. П.А. Герцена – филиал ФГБУ «НМИЦ радиологии» Минздрава России.

МРНЦ им. А.Ф. Цыба – филиал ФГБУ «НМИЦ радиологии» Минздрава России.

код по МКБ 10, лечение

Паховый лимфаденит – это воспаление лимфатических узлов в паху. Болезнь характеризуется яркой симптоматикой, сопровождается болью и представляет серьезную опасность для здоровья, поэтому требует своевременной диагностики и лечения. Проявления и причины болезни одинаковы для мужчин и женщин, чаще всего патологию связывают с воспалительными заболеваниями органов мочеполовой системы и инфекциями, передающимися половым путем.

Что такое лимфаденит?

Паховые лимфоузлы расположены подкожно в области паховой связки, они собирают всю лимфу от ног, промежности, половых органов

Лимфаденитом называется воспаление лимфатических узлов. Патология может поражать лимфатические узлы любой группы. Паховый лимфаденит относится к распространенным патологиям лимфатической системы.

Развитие заболевания обусловлено проникновением инфекции в лимфатические узлы. Как правило, локальное воспаление лимфоузлов связано с заболеваниями органов, расположенных в этой же зоне. Это объясняется функцией лимфоузлов. Они выполняют роль фильтра, очищая лимфу от токсинов и инфекционных микроорганизмов. При инфицировании органов лимфа переносит болезнетворные агенты в лимфатические узлы для дальнейшей фильтрации. В случае ослабления иммунной системы организм не может справиться с болезнетворными агентами своими силами. Лимфатические узлы поглощают патогены из лимфы, однако из-за ослабления иммунитета не могут “очиститься”. Токсины и патогенные микроорганизмы оседают в лимфоузлах, что провоцирует начало воспалительного процесса.

Особенностью пахового лимфаденита у женщин и мужчин является яркая симптоматика, позволяющая своевременно обнаружить болезнь, обратиться к врачу и начать терапию.

Классификация лимфаденитов

Согласно международному классификатору болезней МКБ-10, паховый лимфаденит обозначается кодом L04.8. Как правило, эта болезнь протекает в острой форме, что характеризуется внезапным началом и быстрым нарастанием симптомов.

По характеру течения также выделяют хроническую форму воспалительного процесса. Она развивается на фоне скрыто протекающих инфекционных заболеваний, либо вследствие невылеченного острого воспаления лимфоузлов.

Хроническая форма лимфаденита отличается более сглаженными симптомами, однако сопровождается выраженным дискомфортом, поэтому без внимания со стороны пациента не остается.

По локализации паховый лимфаденит относится к поверхностным воспалительным процессам, что объясняется особенностями расположения этой группы лимфоузлов.

По вовлечению лимфатических узлов паховые лимфадениты у мужчин и женщин бывают односторонними, двусторонними и обширными.

Обратите внимание! В подавляющем большинстве случаев лимфаденит поражает один лимфатический узел.

Односторонним называется воспаление лимфоузла с одной стороны паховой области. Соответственно, при двустороннем лимфадените воспаляются лимфатические узлы слева и справа. Как правило, болезнь относится к локальным воспалениям, то есть поражается по одному узлу с каждой стороны. Тяжелой формой патологии является обширный, или распространенный, паховый лимфаденит, при котором воспаляется вся регионарная группа лимфатических узлов в паху. Эта форма болезни является скорее осложнением локализованного воспалительного процесса, чем самостоятельным заболеванием. Воспаление всей группы обусловлено распространением инфекции с одного лимфатического узла на соседние.

По природе воспаления лимфадениты в паху разделяют на серозные и гнойные. Серозным называется асептическое воспаление, то есть бактериальных агентов в лимфатических узлах нет. Гнойный воспалительный процесс сопровождается образованием нагноения, а при прогрессировании – абсцесса. Абсцессом называется крупная воспаленная полость в органе, наполненная гноем. Гнойное воспаление опасно развитием некроза тканей. Как правило, гнойный лимфаденит в паху у женщин и мужчин развивается из-за отсутствия своевременного лечения серозной формы болезни.

В зависимости от причины развития паховый лимфаденит делят на специфический и неспецифический. Специфический воспалительный процесс связан с развитием сифилиса, гонореи, туберкулеза и др. Неспецифический лимфаденит в паху у мужчин и женщин развивается на фоне воспалительных процессов в органах таза, вызванных условно-патогенными микроорганизмами – стрептококком, стафилококком, кишечной или синегнойной палочкой и т.д. Неспецифический паховый лимфаденит в международной классификации имеет код по МКБ-10 I88.

Симптомы заболевания

Паховый лимфаденит вызывает дискомфорт и боль в паху при движении (в норме лимфоузлы паховой области не прощупываются и внешне не визуализируются)

Лимфаденит в паховой области проявляется одинаково у мужчин и женщин. Основной симптом – значительное увеличение размеров лимфатического узла. В зависимости от локализации воспаления может появляться крупный бугорок в верхней части паха, в середине паховой складки, либо в нижней части лобка.

Признаки и симптомы пахового лимфаденита:

  • сильный отек и увеличение лимфоузла;
  • покраснение кожи в пораженной зоне;
  • боль при пальпации и резких движениях;
  • повышение температуры тела свыше 38 градусов;
  • симптомы общей интоксикации;
  • ночная потливость;
  • упадок сил и слабость.

Воспаленный лимфатический узел сильно увеличивается в размерах и заметно выделяется на фоне паховой области. Появившийся бугорок может достигать 5-7 см в диаметре. Специфическим симптомом воспаления лимфоузла является боль. В случае серозного воспаления болевой синдром чувствуется при пальпации, усиливается при ходьбе из-за трения лимфоузла об одежду. В случае гнойного воспалительного процесса боль присутствует постоянно. В состоянии покоя она пульсирующая и постоянная, а при пальпации усиливается, проявляется резко.

Паховый лимфаденит сопровождается выраженным дискомфортом, так как лимфоузлы этой области постоянно прикрыты одеждой. Ношение тугого белья приводит к еще большему отеку лимфоузла и сильной боли.

К симптомам общей интоксикации относят головную боль, упадок сил, тошноту и слабость. При нагрузках и резких движениях боль может иррадиировать в нижнюю часть живота и поясницу.

При паховом лимфадените лечение следует начинать как можно скорее. Заметив увеличение лимфоузла и появление хотя бы одного из вышеперечисленных симптомов, следует немедленно обратиться к врачу.

Причины заболевания

Как уже упоминалось, паховый лимфаденит может быть вызван специфическими и неспецифическими патогенами. При этом заболевание не первично, а развивается на фоне патологических процессов в органах мочеполовой системы. К специфическим причинам развития лимфаденита у мужчин и женщин относят заболевания, передающиеся половым путем:

  • сифилис;
  • гонорею;
  • трихомониаз;
  • хламидиоз.

Среди специфических болезней, сопровождающихся развитием пахового лимфаденита, также выделяют туберкулез. При заражении палочкой Коха обычно поражаются лимфоузлы грудной клетки и шеи, однако в 10% случаев скрытого туберкулеза могут инфицироваться паховые лимфатические узлы.

Неспецифические причины развития заболевания:

  • кандидоз половых органов;
  • бактериальный уретрит;
  • инфекционный простатит у мужчин;
  • воспалительные заболевания яичников;
  • острый эпидидимит;
  • фурункулез;
  • трофические язвы и абсцессы нижних конечностей.

Инфекция проникает в лимфатические узлы с током лимфы. Воспаление паховых лимфоузлов всегда связано с заболеваниями органов таза или нижних конечностей. Гнойная форма болезни обусловлена действием стрептококка и стафилококка и нередко развивается на фоне образования фурункулов в паху – крупных кожных очагов воспаления, наполненных гноем (нарывы).

Чем опасно заболевание?

Запущенное и не вовремя выявленное заболевание может привести к заражению крови

Паховый лимфаденит сильно подрывает женское и мужское здоровье. Помимо того, что патология вызывает дискомфорт и ухудшает качество жизни, воспаление этой группы лимфоузлов может иметь негативные последствия для всего организма. В первую очередь следует учесть, что заболевание вызывают инфекции, передающиеся половым путем. Некоторые заболевания могут протекать бессимптомно, например, гонорея, поэтому воспаление лимфоузлов может долгое время оставаться единственным видимым нарушением в работе организма. В этом случае необходимо своевременно обратиться к врачу, чтобы выявить опасную инфекцию и пройти лечение.

Обратите внимание! Само по себе наличие очага инфекции в организме очень опасно. При паховом лимфадените важно воздействовать на причину воспаления лимфоузлов, выявить которую можно только путем комплексного обследования.

Гнойное воспаление потенциально опасно образованием абсцесса. Он может прорываться при механическом повреждении, тогда гнойное содержимое проникает в лимфосистему, а затем и в общий кровоток. Это вызывает сепсис – заражение крови. Кроме того, при нагноении в лимфоузлах формируются очаги некроза, что может приводить к появлению гранулем, потенциально опасных риском перерождения клеток в злокачественные, и к образованию свищей.

Диагностика

В первую очередь для диагностики пахового лимфаденита проводят наружный осмотр паха и лимфатических узлов

Для постановки диагноза необходимо пройти обследование у уролога, гинеколога или дерматовенеролога. Сама по себе диагностика лимфаденита не вызывает проблем, однако болезнь важно дифференцировать с лимфомой – злокачественным заболеванием лимфатической системы.

Необходимые анализы и исследования:

  • общий и биохимический анализы крови;
  • урогенитальный мазок;
  • УЗИ лимфоузлов;
  • анализ ПЦР;
  • УЗИ органов малого таза.

При лимфадените выявляются изменения в анализе крови. В первую очередь это проявляется снижением количества лимфоцитов – основных иммунных клеток. Кроме того, по характеру изменений в крови можно исключить лимфому.

Микроскопия урогенитального мазка позволяет исключить наиболее распространенные инфекции половых органов. Для получения более полной картины делается бактериальный посев и анализ ПЦР. На основании этих обследований удается выявить заболевания, передающиеся половым путем.

УЗИ органов таза для женщин и мужчин, а также обследование предстательной железы для мужчин – это необходимые исследования, позволяющие исключить наличие воспалительных заболеваний, которые могут привести к увеличению лимфоузлов.

Как самому определить лимфаденит?

Существует не так много заболеваний лимфоузлов, и самым опасным из них является лимфаденит. При самообследовании его необходимо дифференцировать с лимфаденопатией и лимфомой. Лимфаденопатия не всегда является патологией, это нарушение проявляется увеличением лимфоузлов без воспаления. Главное отличие лимфаденопатии от лимфаденита – отсутствие выраженного болевого синдрома в первом случае.

Отличить болезнь от лимфомы также можно по характеру болевого синдрома и по локализации воспаления. Как правило, при лимфоме заметное увеличение лимфоузлов наблюдается при прогрессировании болезни, однако при этом поражается не одна, а сразу несколько групп лимфатических узлов.

Важно! Ни лимфома, ни лимфаденопатия не сопровождаются высокой температурой и острой болью, в отличие от лимфаденита.

Лечение

Амоксиклав принимают внутрь в начале еды, глотая целиком, не разжевывая и запивая достаточным количеством воды (длительность терапии составляет от 5 до 14 дней)

Лечение лимфаденита в паху направлено на устранение инфекционного воспаления. Для этого назначаются антибиотики при лимфадените паховой зоны. Как правило, применяют фторхинолоны или макролиды. В случае сифилиса и гонореи назначаются комбинированные препараты пенициллиновой группы, например, Амоксиклав.

Лечить паховый лимфаденит следует комплексно. В терапии лимфаденита в паху у женщин и мужчин также используют препараты для уменьшения симптоматики – нестероидные противовоспалительные средства, жаропонижающие препараты, мази и кремы для наружного применения.

Так как основным методом лечения является антибактериальная терапия, лечить болезнь своими силами нельзя. Важно проконсультироваться с врачом, который составит оптимальную схему терапии на основании анализов и после определения чувствительности возбудителя болезни к выбранному препарату.

Рекомендации МГНОТ по COVID-19 и постковидному синдрому 2021

ЛИТЕРАТУРА / REFERENCES


1. Рекомендации МГНОТ по диагностике и интенсивной терапии синдрома диссеминированного внутрисосудистого свертывания крови при вирусном поражении легких. Под редакцией проф. Воробьева П.А. и проф. Елыкомова В.А. Проблемы стандартизации в здравоохранении. 2020; 5-6: 99-111.https://doi.org/10.26347/1607-2502202005-06099-111. [Recommendations for the diagnosis and therapy of disseminated intravascular coagulation syndrome in patients with respiratory viral infections]. Prof. Vorobyov PA, Prof. Elykomov VA, editors. Health Care Standardization Problems. 2020; 5-6: 71-94. https://doi.org/10.26347/1607-2502202005-06099-111. Russian.
2. Mao L, Jin H, Wang M. et al. Neurologic Manifestations of Hospitalized Patients With Coronavirus Disease 2019 in Wuhan, China. JAMA Neurol. 2020;77(6):683–690. https://doi.org/10.1001/jamaneurol.2020.1127.
3. Pezzini A, Padovani A. Lifting the mask on neurological manifestations of COVID-19. Nat Rev Neurol. 2020; 16: 636–644 (2020). https://doi.org/10.1038/s41582-020-0398-3.
4. Parsons T, Banks S, Bae C. et al. COVID-19-associated acute disseminated encephalomyelitis (ADEM). J Neurol. 2020; 267: 2799–2802. https://doi.org/10.1007/s00415-020-09951-9).
5. Moriguchi T, Harii N, Goto J, Harada D, Sugawara HTakamino J, Shimada S. A first case of meningitis/encephalitis associated with SARS-Coronavirus-2. International Journal of Infectious Diseases. 2020; 94: 55–58. https://doi.org/10.1016/j.ijid.2020.03.062.
6. Huang YH, Jiang D, Huang JT. SARS-CoV-2 Detected in Cerebrospinal Fluid by PCR in a Case of COVID-19 Encephalitis. Brain Behav Immun. 2020;87:149. https://doi.org/10.1016/j.bbi.2020.05.012).
7. Poyiadji N, Shahin G, Noujaim D, Stone M, Patel S, Griffith B. COVID-19–associated Acute Hemorrhagic Necrotizing Encephalopathy: Imaging Features. Radiology. 2020; 296(2): E119–E120. https://doi.org/10.1148/radiol.2020201187.
8. Hernández-Fernández F, Sandoval Valencia H., Barbella-Aponte R.A Collado-Jiménez R, Ayo-Martín Ó, Barrena C. et al. Cerebrovascular disease in patients with COVID-19: neuroimaging, histological and clinical description. Brain. 2020; 143(10): 3089–3103. https://doi.org/10.1093/brain/awaa239.
9. Zhao H, Shen D, Zhou H, Liu J, Chen S. Guillain-Barré syndrome associated with SARS-CoV-2 infection: causality or coincidence? The Lancet Neurology 2020; 19(5): 383–384. https://doi.org/10.1016/S1474-4422(20)30109-5.
10. Gutiérrez-Ortiz C, Méndez-Guerrero A, Rodrigo-Rey S, San Pedro-Murillo E, Bermejo-Guerrero L, Gordo-Mañas R. et al. Miller Fisher syndrome and polyneuritis cranialis in COVID-19. Neurology. 2020; 95(5), e601 LP-e605. https://doi.org/10.1212/WNL.0000000000009619.
11. Qin Y, Wu J, Chen T, Li J, Zhang G, Wu D, et al. Long-term microstructure and cerebral blood flow changes in patients recovered from COVID-19 without neurological manifestations. The Journal of Clinical Investigation. 2020; 131(8). https://doi.org/10.1172/JCI147329.
12. Dennis A, Wamil M, Kapur S, Alberts J, Badley AD, Decker GA, Rizza S.A, Banerjee R, BanerjeeA. Multi-organ impairment in low-risk individuals with long COVID. MedRxiv, 2020. https://doi.org/10.1101/2020.10.14.20212555).
13. Ludvigsson JF. Case report and systematic review suggest that children may experience similar long-term effects to adults after clinical COVID-19. Acta Paediatr. 2021; 110: 914– 921. https://doi.org/10.1111/apa.15673.
14. Davido B, Seang S, Tubiana R. & de Truchis P. Post-COVID-19 chronic symptoms: a post-infectious entity? Clin. Microbiol. Infec. 2020; 26: 1448–1449.
15. Brodin P. Immune determinants of COVID-19 disease presentation and severity. Nat Med. 2021; 27: 28–33. https://doi.org/10.1038/s41591-020-01202-8).
16. Guillot X, Ribera A, Gasque P. Chikungunya-Induced Arthritis in Reunion Island: A Long-Term Observational Follow-Up Study Showing Frequently Persistent Joint Symptoms, Some Cases of Persistent Chikungunya Immunoglobulin M Positivity, and No Anticyclic Citrullinated Peptide Seroconversion After 13 Years. The Journal of Infectious Diseases. 2020; 222(10): 1740–1744. https://doi.org/10.1093/infdis/jiaa261.
17. Clark DV, Kibuuka H, Millard M, Wakabi S, Lukwago L, Taylor A, Robb ML. Long-term sequelae after Ebola virus disease in Bundibugyo, Uganda: a retrospective cohort study. The Lancet Infectious Diseases. 2015; 15(8): 905–912. https://doi.org/10.1016/S1473-3099(15)70152-0).
18. Singh SK, Girschick HJ. Lyme borreliosis: from infection to autoimmunity. Clinical Microbiology and Infection. 2004; 10(7): 598–614. https://doi.org/10.1111/j.1469-0691.2004.00895.x).
19. Rebman AW, Yang T, Aucott JN Symptom heterogeneity and patient subgroup classification among US patients with post-treatment Lyme disease: anobservational study. BMJ Open. 2021;11:e040399. https://doi.org/10.1136/bmjopen-2020-040399.
20. Hickie I, Davenport T, Wakefield D, Vollmer-Conna U, Cameron B, Vernon SD, Lloyd A. (). Post-infective and chronic fatigue syndromes precipitated by viral and non-viral pathogens: prospective cohort study. BMJ. 2006; 333(7568): 575. https://doi.org/10.1136/bmj.38933.585764.AE).
21. Rodriguez LST, Pou C, Lakshmikanth T, ZhangJ, Mugabo C H, Wang J, Brodin P. (). Achieving symptom relief in patients with Myalgic encephalomyelitis by targeting the neuro-immune interface and inducing disease tolerance. BioRxiv. 2020. https://doi.org/10.1101/2020.02.20.958249.
22. Lantos PM, Rumbaugh J, Bockenstedt LK, Falck-Ytter YT, Aguero-Rosenfeld ME, Auwaerter PG, Baldwin K, Bannuru RR, Belani KK, Bowie WR, Branda JA, Clifford DB, DiMario FJJr, Halperin JJ, Krause PJ, Lavergne V, Liang MH, Cody Meissner H, Nigrovic LE, Nocton JJ, Osani MC, Pruitt AA, Rips J, Rosenfeld LE, Savoy ML, Sood SK, Steere AC, Strle F, Sundel R, Tsao J, Vaysbrot EE, Wormser GP Zemel LS. Clinical Practice Guidelines by the Infectious Diseases Society of America (IDSA), American Academy of Neurology (AAN), and American College of Rheumatology (ACR): Guidelines for the Prevention, Diagnosis, and Treatment of Lyme Disease. Arthritis Care Res. 2020; 73: 1-9. https://doi.org/10.1002/acr.24495).
23. Post-covid syndrome in individuals admitted to hospital with COVID-19: retrospective cohort study. BMJ. 2021; 372: n693. https://doi.org/10.1136/bmj.n693.
24. Michelen M, Manoharan L, Elkheir N, et al. Characterising long-term covid-19: a rapid livingsystematic review. MedRxiv, 2020. https://doi.org/10.1101/2020.12.08.20246025.
25. ЗайратьянцО.В., CамсоноваМ.В., МихалеваЛ.М., ЧерняевА.Л., МишневО.Д., КрупновН.М., КалининД.В. Патологическаяанатомия COVID-19: Атлас. Под общей ред. О.В. Зайратьянца. М.: ГБУ «НИИОЗММ ДЗМ», 2020. 140 с. Zairatyants OV, Samsonova MV, Mikhaleva LM, Chernyaev AL, Mishnev OD, Krupnov NM, Kalinin DV. [Pathological anatomy of COVID-19: Atlas. Zairatyants OV, chief editor. Moscow: GBU “NIIOZMM DZM”, 2020. 140 p. Russian.
26. Lee MH, Perl DP, Nair G, Li W, Maric D, Murray H, Dodd SJ, Koretsky AP, Watts JA, Cheung V, Masliah E, Horkayne-Szakaly I, Jones R, Stram MN, Moncur J, Hefti M, Folkerth RD, Nath A. Microvascular Injury in the Brains of Patients with Covid-19. N Engl J Med. 2021;384(5):481-483. https://doi.org/10.1056/NEJMc2033369.
27. Boldrini M, Canoll PD, Klein RS. How COVID-19 Affects the Brain. JAMA Psychiatry. 2021; 78 (6):682-683. https://doi.org/10.1001/jamapsychiatry.2021.0500.
28. Varga Z, Flammer AJ, Steiger P, Haberecker M, Andermatt R, Zinkernagel AS. et al. Endothelial cell infection and endotheliitis in COVID-19. The lancet. 2020; 396 (10234): 1417-1418. https://doi.org/10.1016/S0140-6736(20)30937-5.
29. Lei Y, Zhang J, Schiavon CR, He M, Chen L, Shen H, Zhang Y, Yin Q, Cho Y, Andrade L, Shadel GS, Hepokoski M, Lei T, Wang H, Zhang J, Yuan JX, Malhotra A, Manor U, Wang S, Yuan ZY, Shyy JY. SARS-CoV-2 Spike Protein Impairs Endothelial Function via Downregulation of ACE. Circulation Research 22021; 128: 1323-1326. https://doi.org/10.1161/CIRCRESAHA.121.318902.
30. Michelen M, Cheng V, Manoharan L, Elkheir L, Dagens D, Hastie C, O’Hara M, Suett JC , Dahmash DT, Bugaeva P, Rigby I, Munblit D, Harriss E, Burls A, Foote C, Scott JT, Carson G, Olliaro P, Sigfrid L, Stavropoulou C.Characterising long-term covid-19: a rapid living systematic review. MedRxiv. https://doi.org/10.1101/2020.12.08.20246025.
31. Cirulli ET, Schiabor Barrett KM, Riffle S, Bolze A, Neveux I, Dabe S, Grzymski JJ,. Lu JT, Washington NL. Long-term COVID-19 symptoms in a large unselected population. MedRxiv, 2020. https://doi.org/10.1101/2020.10.07.20208702.
32. Al-Aly Z, Xie Y & Bowe B. High-dimensional characterization of post-acute sequalae of COVID-19. Nature.2021; 594: 259-264. https://doi.org/10.1038/s41586-021-03553-9.
33. Воробьев А.П., Воробьев П.А., Муканин Д.А., Краснова Л.С. Эффективность системы искусственного интеллекта MeDiCase при диагностике инфекции COVID-19 в амбулаторных условиях. Проблемы стандартизации в здравоохранении. 2020; 11-12: 27-36. DOI: https://doi.org/10.26347/1607-2502202011-12027-036 27-36. VorobievAP, VorobyevPA, MukaninDA, KrasnovaLS. Efficiency of the Medicase AI System in diagnosing COVID-19 in ambulatory conditions. HealthCare Standardization Problems. 2020; 11-12: 27-36. https://doi.org/10.26347/1607-2502202011-12027-036. Russian.
34. Ющук Н. Д. Инфекционные болезни: синдромальная диагностика. Под ред. Н.Д. Ющука, Е.А. Климовой. М.: ГЭОТАР-Медиа, 2017. 176 с. ISBN 978-5-9704-4045-2. Yushchuk ND. [Infectious diseases: syndromal diagnostics]. Yushchuk ND, Klimova EA, editors. Moscow: GEOTAR-Media, 2017. 176 p. ISBN 978-5-9704-4045-2. Russian.
35. Lesort C, Kanitakis J, Villani A et al. COVID‐19 and outbreak of chilblains: are they related? J Eur Acad Dermatol Venereol. 2020; 34: e757–e758. https://doi.org/10.1111/jdv.16779.
36. Birlutiu V, Feiereisz AI, Oprinca G, Dobritoiu S, Rotaru M, Birlutiu RM, Iancu GM.Cutaneous manifestations associated with anosmia, ageusia and enteritis in SARS-CoV-2 infection – a possible pattern? Observational study and review of the literature. Int J Infect Dis. 2021; 107: 72-77. https://doi.org/10.1016/j.ijid.2021.04.058.
37. Conforti C, Dianzani C, Agozzino M, Giuffrida R, Marangi GF, Meo ND, Morariu SH, Persichetti P, Segreto F, Zalaudek I, Neagu N. Cutaneous Manifestations in Confirmed COVID-19 Patients: A Systematic Review. Biology. 2020; 9(12):449. https://doi.org/10.3390/biology9120449.
38. Genovese G, Moltrasio C, Berti E, Marzano AV. Skin Manifestations Associated with COVID-19: Current Knowledge and Future Perspectives.Dermatology. 2021;237(1):1-12. https://doi.org/10.1159/000512932.
39. Novak N, Peng W, Naegeli MC, Galvan C, Kolm-Djamei I, Brüggen C, Cabanillas B, Schmid-Grendelmeier P, Catala A.SARS-CoV-2, COVID-19, skin and immunology – What do we know so far? Allergy. 2021;76(3):698-713. https://doi.org/10.1111/all.14498.
40. FIvenson D. COVID-19: association with rapidly progressive forms of alopecia areata. International Journal of Dermatology. 2020; 60(1): 127-127. https://doi.org/10.1111/ijd.15317.
41. Zhou T, Su TT, Mudianto T, Wang J. Immune asynchrony in COVID-19 pathogenesis and potential immunotherapies. J Exp Med. 2020;217(10):e20200674. https://doi.org/10.1084/jem.20200674.
42. Machado PM. Pathophysiology of acute respiratory syndrome coronavirus 2 infection: a systematic literature review to inform EULAR points to consider. RMD Open. 2021;7(1):e001549. https://doi.org/10.1136/rmdopen-2020-001549.
43. Насонов Е.Л. Коронавирусная болезнь 2019 (COVID-19): размышления ревматолога. Научно-практическаяревматология. 2020;58(2):123-132. https://doi.org/10.14412/1995-4484-2020-123-132. Nasonov EL. Coronavirus disease 2019 (COVID-19): a rheumatologist’s thoughts. NauchnoPrakticheskaya Revmatologiya. Rheumatology Science and Practice. 2020;58(2):123-132. doi: 10.14412/1995-4484-2020-123-132. Russian.
44. Leisman DE, Ronner L, Pinotti R, Taylor MD, Sinha P, et al. Cytokine elevation in severe and critical COVID-19: a rapid systematic review, meta-analysis, and comparison with other inflammatory syndromes. Lancet Respir Med. 2020;8(12):1233-1244. https://doi.org/10.1016/S2213-2600(20)30404-5.
45. Weatherhead JE, Clark E, Vogel TP, Atmar RL, Kulkarni PA. Inflammatory syndromes associated with SARS-CoV-2 infection: dysregulation of the immune response across the age spectrum. J Clin Invest. 2020;130(12):6194-6197. https://doi.org/10.1172/JCI145301.
46. Dalakas MC. Guillain-Barré syndrome: The first documented COVID-19-triggered autoimmune neurologic disease: more to come with myositis in the offing. Neurol Neuroimmunol Neuroinflamm. 2020; 7:e781. https://doi.org/10.1212/NXI.0000000000000781.
47. Bhattacharjee S, Banerjee M. Immune thrombocytopenia secondary to COVID-19: a systematic review. SN Compr Clin Med. 2020; 1–11. https://doi.org/10.1007/s42399-020-00521-8.
48. Perez-Toledo M, Faustini SE, Jossi SE, Shields AM, Kanthimathinathan HK, Allen JD, et al. Serology confirms SARS-CoV-2 infection in PCR-negative children presenting with Paediatric Inflammatory Multi-System Syndrome. MedRxiv 2020. https://doi.org/10.1101/2020.06.05.20123117.
49. Consiglio CR, Cotugno N, Sardh F, Pou C, Amodio D, Rodriguez L, et al. The immunology of multisystem inflammatory syndrome in children with COVID-19. Cell. 2020; 183: 968– 81.e7. https://doi.org/10.1016/j.cell.2020.09.016.
50. Gruber CN, Patel RS, Trachtman R, Lepow L, Amanat F, Krammer F, et al. Mapping systemic inflammation and antibody responses in multisystem inflammatory syndrome in children (MIS-C). Cell. 2020; 183: 982– 995.e14. https://doi.org/10.1016/j.cell.2020.09.034.
51. Vlachoyiannopoulos PG, Magira E, Alexopoulos H, Jahaj E, Theophilopoulou K, Kotanidou A, et al. Autoantibodies related to systemic autoimmune rheumatic diseases in severely ill patients with COVID-19. Ann Rheum Dis. 2020; 79: 1661–1663. https://doi.org/10.1136/annrheumdis-2020-218009.
52. Borghi MO, Beltagy A, Garrafa E, Curreli D, Cecchini G, Bodio C, et al. Anti-phospholipid antibodies in COVID-19 are different from those detectable in the anti-phospholipid syndrome. Front Immunol. 2020; 11: 584241. https://doi.org/10.3389/fimmu.2020.584241.
53. Galeano-Valle F, Oblitas CM, Ferreiro-Mazón MM, Alonso-Muñoz J, del Toro-Cervera J, di Natale M, et al. Antiphospholipid antibodies are not elevated in patients with severe COVID-19 pneumonia and venous thromboembolism. Thromb Res. 2020; 192: 113–115. https://doi.org/10.1016/j.thromres. 2020.05.017.
54. Bastard P, Rosen LB, Zhang Q, Michailidis E, Hoffmann HH, Zhang Y, et al. Autoantibodies against type I IFNs in patients with life-threatening COVID-19. Science. 2020; 370(6515):eabd4585.https://doi.org/10.1126/наука.abd458.
55. Wang EY, Mao T, Klein J, Dai Y, Huck JD, Liu F, et al. Diverse Functional Autoantibodies in Patients with COVID-19. MedRxiv. 2020. https://doi.org/10.1101/2020.12.10.20247205.
56. Kreye J, Reincke SM, Prüss H. Do cross-reactive antibodies cause neuropathology in COVID-19? Nat Rev Immunol. 2020; 20: 645–646. https://doi.org/10.1038/s41577-020-00458-у.
57. RichterAG, ShieldsAM, Karim A, Birch D, FaustiniSE. Establishing the prevalence of common tissue-specific autoantibodies following severe acute respiratory syndrome coronavirus 2 infection. Clinical & Experimental Immunology. 2021; 205 (2): 99-105. https://doi.org/10.1111/cei.13623.
58. Ramos-Casals M., Brito-Zerón P. & Mariette X. Systemic and organ-specific immune-related manifestations of COVID-19. Nat Rev Rheumatol. 2021; 17:315-332. https://doi.org/10.1038/s41584-021-00608-z.
59. Novelli L, Motta F, De Santis M, Ansari AA, Gershwin ME, Selmi C. The JANUS of chronic inflammatory and autoimmune diseases onset during COVID-19 – A systematic review of the literature. J Autoimmunity. 2021; 117, 102592. https://doi.org/10.1016/j.jaut.2020.102592.
60. Ciaffi J, Meliconi R, Ruscitti P, Berardicurti O, Giacomelli R, Ursini F. Rheumatic manifestations of COVID-19: a systematic review and meta-analysis. BMC Rheumatol. 2020;4:65. https://doi.org/10.1186/s41927-020-00165-0.
61. Gupta A, Madhavan MV, Sehgal K, Nair N, Mahajan S, et al. Extrapulmonarymanifestations of COVID-19. Nat Med. 2020;26(7):1017-1032. https://doi.org/10.1038/s41591-020-0968-3.
62. Насонов ЕЛ. Коронавирусная болезнь 2019 (COVID-19) и аутоиммунитет. Научно-практическая ревматология. 2021;59(1):5-30. https://doi.org/10.47360/1995-4484-2021-5-30. NasonovE.L. [Coronavirusdisease 2019 (COVID-19) andautoimmunity]. Rheumatology Science and Practice. 2021;59(1):5-30. https://doi.org/10.47360/1995-4484-2021-5-30. Russian.
63. Насонов ЕЛ, Бекетова ТВ, Решетняк ТМ, и соавт. Коронавирусная болезнь 2019 (COVID-19) и иммуновоспалительные ревматические заболевания: на перекрестке проблем тромбовоспаления и аутоиммунитета. Научно-практическаяревматология. 2020;58(4):353-367. https://doi.org/10.47360/1995-4484-2020-353-367. Nasonov E.L., Beketova T.V., Reshetnyak T.M., Lila A.M., Ananieva L.P., Lisitsyna T.A., Soloviev S.K. [Coronavirus disease 2019 (COVID-19) and immune-mediated inflammatory rheumatic diseases: at the crossroads of thromboinflammation and autoimmunity]. Rheumatology Science and Practice. 2020;58(4):353-367. https://doi.org/10.47360/1995-4484-2020-353-367. Russian.
64. Schett G, Manger B, Simon D, Caporali R. COVID-19 revisiting inflammatory pathways of arthritis. Nat Rev Rheumatol. 2020;16(8):465-470. https://doi.org/10.1038/s41584-020-0451-z.
65. Liu Y, Sawalha AH, Lu Q. COVID-19 and autoimmune diseases. Curr Opin Rheumatol. 2021; 33(2): 155-162. https://doi.org/10.1097/BOR.0000000000000776.
66. Аксёнова А.Ю. Фактор Фон Виллебранда и повреждение эндотелия: возможная связь с COVID-19. Экологическаягенетика. 2020; 18 (2): 135-138. https://doi.org/10.17816/ecogen33973. Aksenova A.Y. [Von Willebrand factor and endothelial damage: a possible association with COVID-19]Ecological genetics. 2020; 18 (2): 135-138. https://doi.org/10.17816/ecogen33973. Russian.
67. Doevelaar A, Bachmann M, Hölzer B, Seibert FS, Rohn B S, Bauer F, Witzke O. at ol.COVID-19 is associated with relative ADAMTS13 deficiency and VWF multimer formation resembling TTP. MedRxiv. https://doi.org/10.1101/2020.08.23.20177824.
68. Duanab K, Premicd E, Pilottod A, Cristillod V, Benussi A, Librid L, Giuntad M, Bockholtb HJ, Liube J, Camporaf R, Pezzinid A, Gasparottif R, Magonic M, Padovanid A, Calhoun VD. Alterations of frontal-temporal gray matter volume associate with clinical measures of older adults with COVID-19. Neurobiology of Stress. 2021; 14: 100326. https://doi.org/10.1016/j.ynstr.2021.100326.
69. Lovell N, Maddocks M, Etkind SN, Taylor K, Carey I, Vora V, Marsh L, Higginson IJ, Prentice W, Edmonds P, Sleeman KE. Characteristics, symptom management, and outcomes of 101 patients with COVID-19 referred for hospital palliative care. J. Pain Symptom Manage. 2020; 60 (1): e77-e81. https://doi.org/10.1016/j.jpainsymman.2020.04.015 71.
70. Karimi-Galougahi M, Yousefi-Koma A, Bakhshayeshkaram M, Raad N, Haseli S. 18FDG PET/CT Scan Reveals Hypoactive Orbitofrontal Cortex in Anosmia of COVID-19. Acad Radiol. 2020; 27(7):1042-1043. https://doi.org/10.1016/j.acra.2020.04.030.
71. Crunfli F, Carregari VC, Veras FP, Vendramini PH Fragnani AG, Valença, Antunes ASLM., Brandão-Teles C, Zuccoli GS. at al. SARS-CoV-2 infects brain astrocytes of COVID-19 patients and impairs neuronal viability. MedRxiv. 2020. https://doi.org/10.1101/2020.10.09.20207464.
72. Kavitha PK. Coronavirus Disease (Covid-19) in India – An Overview”. Acta Scientific Medical Sciences. 2020; 4.5: 64-70. https://doi.org/10.31080/ASMS.2020.04.0622.
73. Duan K, Premi E, Pilotto A, Cristillo V, Benussi A, Libri I, Giunta M, Bockholt HJ, Liu J, Campora R, Pezzini A, Gasparotti R, Magoni M, Padovani A, Calhoun VD. Alterations of frontal-temporal gray matter volume associate with clinical measures of older adults with COVID-19. Neurobiol Stress. 2021;14:100326. https://doi.org/10.1016/j.ynstr.2021.100326.
74. Meinhardt J, Radke J, Dittmayer C. et al. Olfactory transmucosal SARS-CoV-2 invasion as a port of central nervous system entry in individuals with COVID-19. Nat Neurosci. 2021; 24: 168–175. https://doi.org/10.1038/s41593-020-00758-5.
75. Lee MH, Perl DP, Nair G, Li W, Maric D, Murray H, Dodd SJ, Koretsky AP, Watts JA, Cheung V, Masliah E, Horkayne-Szakaly I, Jones R, Stram MN, Moncur J, Hefti M, Folkerth RD, Nath A. Microvascular Injury in the Brains of Patients with Covid-19. N Engl J Med. 2021;384(5):481-483. https://doi.org/10.1056/NEJMc2033369.
76. Román GC, Gracia F, Torres A, Palacios A, Gracia K, Harris D. Acute Transverse Myelitis (ATM):Clinical Review of 43 Patients With COVID-19-Associated ATM and 3 Post-Vaccination ATM Serious Adverse Events With the ChAdOx1 nCoV-19 Vaccine (AZD1222). Front Immunol. 2021;12:653786. https://doi.org/10.3389/fimmu.2021.653786.
77. Delamarre L, Gollion C, Grouteau G, Rousset D, Jimena G, Roustan J, Gaussiat F, Aldigé E, Gaffard C, Duplantier J, Martin C, Fourcade O, Bost C, Fortenfant F, Delobel P, Martin-Blondel G, Pariente J, Bonneville F, Geeraerts T; NeuroICU Research Group. COVID-19–associated acute necrotising encephalopathy successfully treated with steroids and polyvalent immunoglobulin with unusual IgG targeting the cerebral fibre network. J Neurol Neurosurg Psychiatry. 2020; 91(9):1004-1006. https://doi.org/10.1136/jnnp-2020-323678.
78. Ashwin A. Pinto, Liam S. Carroll, Vijay Nar, Aravinthan Varatharaj, Ian Galea CNS inflammatory vasculopathy with antimyelin oligodendrocyte glycoprotein antibodies inCOVID-19. Neurol Neuroimmunol Neuroinflamm. 2020; 7 (5): e813. https://doi.org/10.1212/NXI.0000000000000813.
79. Alobaida S, Lam JM. Beau lines associated with COVID-19. CMAJ. 2020; 8;192(36):E1040. https://doi.org/10.1503/cmaj.201619.
80. COVID-19 rapid guideline: managing the long-term effects of COVID-19 NICE guideline [NG188]. National Institute for Health and Care Excellence. 2020. PMID: 33555768.
81. Goldstein D.S. The extended autonomic system, dyshomeostasis, and COVID-19. Clin Auton Res. 2020;30(4):299–315. https://doi.org/10.1007/s10286-020-00714-0).
82. Delorme C, Paccoud O, Kas A, Hesters A, Bombois S, Shambrook P, Boullet A, Doukhi D, Le Guennec L, Godefroy N, Maatoug R, Fossati P, Millet B, Navarro V, Bruneteau G, Demeret S, Pourcher V; CoCo-Neurosciences study group and COVID SMIT PSL study group. COVID-19-related encephalopathy: a case series with brain FDG-positron-emission tomography/computed tomography findings. Eur. J. Neurol.2020; 27 (12): 2651-2657. https://doi.org/10.1111/ene.14478.
83. Лучевая диагностика коронавирусной болезни (COVID-19): организация, методология, интерпретация результатов: препринт No ЦДТ. 2020 – II. Версия 2 от 17.04.2020 сост. С. П. Морозов, Д. Н. Проценко, С. В. Сметанина [и др.]. Серия «Лучшие практики лучевой и инструментальной диагностики». Вып. 65. М.: ГБУЗ «НПКЦ ДиТ ДЗМ», 2020. 78 с. [Radiation diagnostics of coronavirus disease (COVID-19): organization, methodology, interpretation of results: Preprint No. CDT. 2020-II. Version 2 as of 17.04.2020. Compiled by Morozov SP, Protsenko DN, Smetanina SV, et al. Best Practices of Radiation and Instrumental Diagnostics]. Issue 65. Moscow: Moscow Center for Diagnostics and Telemedicine; 2020. 78 p. Russian.
84. Mirzaev KB, Kiselev Y, Ivashchenko DV, Otdelenov V, Sychev DA. Supporting frontline clinicians in the time of the pandemic: Rapid response pharmacology team. Br J Clin Pharmacol. 2021; 87(3):725-729. https://doi.org/10.1111/bcp.14526.
85. Geldsetzer P. Use of Rapid Online Surveys to Assess People’s Perceptions During Infectious Disease Outbreaks: A Cross-sectional Survey on COVID-19. J Med Internet Res. 2020; 22(4):e18790. https://doi.org/10.2196/18790.
86. Drew DA, Nguyen LH Steves CJ, Menni C, Freydin M, Varsavsky T, Sudre CH, Cardoso MJ, Ourselin S, Wolf J, Spector TD, Chan AT. Rapid implementation of mobile technology for real-time epidemiology of COVID-19, Science. 2020; 368 (6497):1362-1367. https://doi.org/10.1126/science.abc0473.
87. Sudre CH, Murray B, Varsavsky T, Graham MS, Penfold RS, Bowyer RC, Pujol JC, Klaser K, Antonelli M, Canas LS, Molteni E, Modat M, Jorge Cardoso M, May A, Ganesh S, Davies R, Nguyen LH, Drew DA, Astley CM, Joshi AD, Merino J, Tsereteli N, Fall T, Gomez MF, Duncan EL, Menni C, Williams FMK, Franks PW, Chan AT, Wolf J, Ourselin S, Spector T, Steves CJ. Attributes and predictors of Long-COVID. Nat Med. 2021; 27(4):626-631. https://doi.org/10.1038/s41591-021-01292-y.
88. Paranjpe I, Fuster V, Lala A, Russak AJ, Glicksberg BS, Levin MA, Charney AW, Narula J, Fayad ZA, Bagiella E, Zhao S, Nadkarni GN. Association of Treatment Dose Anticoagulation with In-Hospital Survival Among Hospitalized Patients with COVID-19. J Am Coll Cardiol. 2020; 76(1):122-124. https://doi.org/10.1016/j.jacc.2020.05.001.
89. Воробьев П.А. Диагностика и лечение патологии гемостаза. М.: «Ньюдиамед», 2011. Vorobyev PA. [Diagnosis and treatment of hemostasis pathology]. Moscow, Newdiamed Publishing House, 2011. Russian.
90. Nadkarni GN, Lala A, Bagiella E, Chang HL, Moreno PR, Pujadas E, Arvind V, Bose S, Charney AW, Chen MD, Cordon-Cardo C, Dunn AS, Farkouh ME, Glicksberg BS, Kia A, Kohli-Seth R, Levin MA, Timsina P, Zhao S, Fayad ZA, Fuster V. Anticoagulation, Bleeding, Mortality, and Pathology in Hospitalized Patients With COVID-19. J Am Coll Cardiol. 2020; 76(16):1815-1826. https://doi.org/10.1016/j.jacc.2020.08.041.
91. Granger CB, Alexander JH, McMurray JJ, Lopes RD, Hylek EM, Hanna M, Al-Khalidi HR, Ansell J, Atar D, Avezum A, Bahit MC, Diaz R, Easton JD, Ezekowitz JA, Flaker G, Garcia D, Geraldes M, Gersh BJ, Golitsyn S, Goto S, Hermosillo AG, Hohnloser SH, Horowitz J, Mohan P, Jansky P, Lewis BS, Lopez-Sendon JL, Pais P, Parkhomenko A, Verheugt FW, Zhu J, Wallentin L; ARISTOTLE Committees and Investigators. Apixaban versus warfarin in patients with atrial fibrillation. N Engl J Med. 2011; 365(11):981-92. https://doi.org/10.1056/NEJMoa1107039.
92. Lip GYH, Keshishian AV, Kang AL, Dhamane AD, Luo X, Li X, Balachander N, Rosenblatt L, Mardekian J, Pan X, Di Fusco M, Garcia Reeves AB, Yuce H, Deitelzweig S. Oral anticoagulants for nonvalvular atrial fibrillation in frail elderly patients: insights from the ARISTOPHANES study. J Intern Med. 2021; 289(1):42-52. https://doi.org/10.1111/joim.13140.
93. Pisters R, Lane DA, Nieuwlaat R, de Vos CB, Crijns HJ, Lip GY. A novel user-friendly score (HAS-BLED) to assess 1-year risk of major bleeding in patients with atrial fibrillation: the Euro Heart Survey. Chest. 2010; 138(5):1093-100. https://doi.org/10.1378/chest.10-0134.
94. Abraham NS. Prevention of Gastrointestinal Bleeding in Patients Receiving Direct Oral Anticoagulants. The American Journal ofGastroenterology Supplements.2016; 3(1):2-12. https://doi.org/10.1038/ajgsup.2016.2.
95. Переверзев А.П., Остроумова О.Д., Ткачева О.Н., Котовская Ю.В. Осложнения фармакотерапии новыми оральными антикоагулянтами, вызванные межлекарственным взаимодействием: акцент на желудочно-кишечные кровотечения. Безопасность и риск фармакотерапии. 2019: 2: 65-71. https://doi.org/10.30895/2312-7821-2019-7-2-65-71. PereverzevAP, OstroumovaOD, TkachevaON, KotovskayaYuV. [Complications of pharmacotherapy with new oral anticoagulants caused by inter-drug interactions: focus on gastrointestinal bleeding. Bezopasnost’ i risk farmakoterapii = Safety and Risk of Pharmacotherapy]. 2019;7(2):65–71. https://doi.org/10.30895/2312-7821-2019-7-2-65-71. Russian.
96. Testa S, Prandoni P, Paoletti O, Morandini R, Tala M, Dellanoce C, Giorgi-Pierfranceschi M, Betti M, Danzi GB, Pan A, Palareti G. Direct oral anticoagulant plasma levels’ striking increase in severe COVID-19 respiratory syndrome patients treated with antiviral agents: The Cremona experience. J Thromb Haemost. 2020; 18(6):1320-1323. https://doi.org/10.1111/jth.14871.
97. Бельдиев С.Н. Практические аспекты применения апиксабана в клинической практике: продолжение темы. РациональнаяФармакотерапиявКардиологии. 2015;11(5): 534-547. Bel’diev SN. [Practical aspects of apixaban use in clinical practice: continuing the theme]. Rational Pharmacotherapy in Cardiology. 2015;11(5):534-547. Russian.
98. Alexander JH, Lopes RD, James S, et al. Apixaban with antiplatelet therapy after acute coronary syndrome. N Engl J Med. 2011; 365:699-708 https://doi.org/10.1056/NEJMoa1105819.
99. Tai FWD, McAlindon ME. NSAIDs and the small bowel. Curr Opin Gastroenterol. 2018; 34:175-82. https://doi.org/10.1097/MOG.0000000000000427.

Лимфаденопатия – Клинические методы – Книжная полка NCBI

Определение

Нечасто пациенты отмечают увеличение лимфатических узлов и обращаются с основной жалобой на узелок, опухшую железу, «узел» или увеличенные лимфатические узлы; чаще пациенты не осознают, что у них значительно увеличены лимфатические узлы, и лимфаденопатия обнаруживается врачом. Поскольку лимфаденопатия может быть связана с широким спектром заболеваний, охватывающих относительно доброкачественные медицинские проблемы, такие как стрептококковый фарингит, до опасных для жизни заболеваний, таких как злокачественные новообразования, обнаружение увеличенных узлов представляет собой важное физическое открытие, которое требует систематической оценки.

Техника

При поиске лимфатических узлов нужно действовать осторожно; в противном случае лимфатические узлы, которые только минимально увеличены или встроены в ткань, могут быть незаметны. Особое внимание следует уделять размеру, форме и консистенции увеличенных узлов. Гладкие и относительно мягкие, но слегка увеличенные лимфатические узлы могут быть нормальными и при биопсии выявлять только гиперплазию. Увеличенные лимфатические узлы неправильной формы и эластичной твердой консистенции могут быть инфильтрированы злокачественными клетками.Болезненные узлы указывают на воспалительный процесс. Сплетенные узлы или узлы, прикрепленные к нижележащим структурам, должны вызывать вопрос о злокачественности или инфекции; свободно подвижные узлы чаще возникают в доброкачественных условиях.

Степень и локализация лимфаденопатии важны для определения и предоставления диагностических ключей к причине лимфаденопатии. Все основные цепи лимфатических узлов следует оценивать систематически. Начните с визуального осмотра области на предмет асимметрии или эритемы.Прощупайте систематически, охватывая все доступные лимфатические узлы. Для исследования лимфатических узлов шеи пациент сидит или стоит лицом к исследователю. Правая рука исследователя исследует левую сторону шеи пациента, а затем левая рука исследователя исследует правую сторону шеи пациента. Начиная с верхней части шеи и вниз, следует оценивать все различные цепи шейных лимфатических узлов, включая преаурикулярные, задние ушные, затылочные, верхние шейные, задние шейные, подчелюстные, субментальные, нижние глубокие шейные и надключичные, как указано. в .При отсутствии генерализованной аденопатии увеличение определенных групп шейных лимфатических узлов может быть полезным с диагностической точки зрения. Например, задняя предсердная аденопатия предполагает краснуху, тогда как односторонняя передняя предсердная аденопатия связана с поражением конъюнктивы и век с результирующим окулогландулярным синдромом, наблюдаемым при трахоме, туляремии, лихорадке кошачьих царапин, туберкулезе, сифилисе, эпидемическом кератоконъюнктивите и вспышках аденозного вируса. фарингоконъюнктивальная лихорадка 3-го типа.Инфекции ротоглотки и зубов также могут вызывать аденопатию шейки матки. Двусторонняя аденопатия шейки матки также проявляется при туберкулезе, кокцидиоидомикозе, инфекционном мононуклеозе, токсоплазмозе, саркоиде, лимфомах и лейкозах. Однако одностороннее образование шейки матки, которое является твердым и безболезненным, всегда должно вызывать вопрос о невыявленной карциноме носоглотки.

Надключичная аденопатия почти всегда протекает ненормально. Когда это не является частью генерализованной лимфаденопатии, это указывает на первичное злокачественное новообразование в брюшной полости или грудной клетке.Правосторонние надключичные узлы дренируют части легкого и средостение и являются сигналами внутригрудных поражений, особенно в легких и пищеводе. Левосторонние надключичные узлы, которые носят эпоним «узлы Вирхова», расположены близко к грудному протоку и часто сигнализируют об внутрибрюшных опухолях, особенно из желудка, яичников, яичек или почек. Надключичные узлы иногда расположены глубоко, и часто бывает полезно, чтобы пациент выполнил маневр Вальсальвы, чтобы подтолкнуть купол легкого вверх, тем самым перемещая эти глубоко расположенные узлы в более доступное положение для пальпации.Если отмечается надключичная аденопатия, пациента следует тщательно обследовать на предмет внутригрудной и средостенной лимфаденопатии. Хотя для подтверждения этого типа лимфаденопатии часто требуется рентген грудной клетки или компьютерная томография, тупость при перкуссии над манубрием иногда свидетельствует о новообразовании в переднем средостении или узлах средостения.

Затем пациента следует обследовать на предмет подмышечной аденопатии. Пациент может сидеть или лежать на спине. Рука пациента, поддерживаемая одной из рук исследователя, должна быть слегка согнута и приведена.Правая рука экзаменатора используется для осмотра левой подмышечной впадины пациента, а левая рука – для правой подмышечной впадины, как показано на рис. Пальцы экзаменатора должны быть слегка скованы наручниками и должны доходить как можно выше до вершины подмышечной впадины. Пальцы опускаются медленно, слегка надавливая на грудную клетку. Этот маневр следует повторить несколько раз, чтобы исследовать латеральную группу, медиальную группу и грудную группу подмышечных узлов. Подмышечная аденопатия может быть частью генерализованного процесса или может быть локализованной и вторичной по отношению к инфекции конечности.Следует тщательно искать местную инфекцию или травму, вызвавшую аденопатию. Сопутствующая эпитрохлеарная, подмышечная и надключичная аденопатия должна вызывать вопрос о лихорадке кошачьих царапин. У женщин односторонние подмышечные узлы вызывают подозрение на ипсилатеральный рак груди.

Рисунок 149.2

(А) Техника пальпации подмышечных узлов. (B) Техника пальпации эпитрохлеарных лимфатических узлов. (От судьи RD, Zuidema GD, ред. Физический диагноз: физиологический подход.Бостон: Литтл, Браун, 1963; 225.)

Затем пациента следует обследовать на предмет возможности образования эпитрохлеарных узлов. Часто эти узлы упускаются из виду или для их исследования используются неадекватные методы. Эпитрохлеарные узлы лучше всего искать, когда локоть пациента согнут примерно на 90 °. Доступ к правой эпитрохлеарной области осуществляется путем вставления левой руки экзаменатора из-за локтя пациента, в то время как правая рука экзаменатора захватывает правое запястье пациента, поддерживая предплечье, как в.Четвертый и пятый пальцы должны находиться чуть выше медиального надмыщелка плечевой кости, а затем остальные пальцы должны лежать на области, где обычно находятся эпитрохлеарные узлы. Обследование левой эпитрохлеарной области как раз наоборот. Эпитрохлеарные узлы обычно увеличиваются вследствие инфекций кисти и предплечья. Иногда опухолевые процессы проявляются изолированной эпитрохлеарной аденопатией. Увеличенные эпитрохлеарные узлы часто возникают при мононуклеозе. В прошлом эпитрохлеарная лимфаденопатия считалась диагностически важным признаком вторичного сифилиса, но теперь она чаще возникает из-за повторяющихся травм руки или инфекций у людей, занимающихся физическим трудом.

Иногда лимфатические узлы могут быть обнаружены в непосредственной близости от пупка. Эти узлы имеют эпоним «узел сестры Марии Джозеф» и являются сигналом значительной внутрибрюшной лимфаденопатии, обычно связанной со злокачественными процессами.

Следует тщательно обследовать паховую область на предмет значительной лимфаденопатии. Взрослые нередко имеют так называемые «рваные» узлы в паховой области. Эти рваные узлы обычно твердые, не закреплены и имеют диаметр менее сантиметра.Они возникают в результате повторяющихся инфекций и травм ступней и ног. Значительно увеличенные и болезненные узлы в паховой области, которые не являются частью генерализованной лимфаденопатии, должны указывать на множество состояний, включая сифилис, шанкроид и венерическую лимфогранулему. Односторонняя паховая лимфаденопатия обычно является реакцией на инфекцию ипсилатеральной нижней конечности. Паховая аденопатия также может быть частью системных процессов, таких как лимфома или лейкемия.

Бедренная аденопатия обычно располагается в бедренном треугольнике в области узла Клоке.Хотя бедренная аденопатия также может быть вторичной по отношению к хронической инфекции и травме, она гораздо чаще имеет патологическое значение, чем паховая аденопатия.

Иногда лимфаденопатия может быть обнаружена в подколенной ямке. Эта аденопатия может быть частью генерализованного процесса или может быть локализована вторично по отношению к инфекции или травме нижней конечности.

Многие важные группы лимфатических узлов невозможно оценить при физикальном обследовании. Если есть доказательства генерализованной аденопатии, эти группы следует тщательно обследовать.Аденопатия корней и средостения может повредить региональные структуры, такие как верхняя полая вена или трахея, и потенциально вызвать опасные для жизни осложнения.

В брюшной полости имеется несколько групп лимфатических узлов, включая брыжеечные, парааортальные, глютеновые и ретрогастральные. Объемная аденопатия брюшной полости также может повредить структуры, включая мочеточники и нижнюю полую вену, и может вызвать такие осложнения, как почечная недостаточность. Абдоминальную аденопатию обычно оценивают с помощью компьютерной томографии брюшной полости, сканирования галлия, ультразвукового исследования или лимфангиографии.

Селезенка является частью лимфатической системы и требует тщательного обследования у любого пациента, у которого присутствует другая лимфаденопатия.

Фундаментальная наука

По всему телу собрано более 500 лимфатических узлов в различные группы. Эти узлы представляют собой неотъемлемую часть как иммунологической, так и ретикулоэндотелиальной систем. Отдельные лимфатические узлы состоят из лимфоцитов, сгруппированных в лимфоидные фолликулы, и ретикулоэндотелиальных клеток, выстилающих узловые пазухи. Каждый фолликул содержит зародышевый центр, населенный быстро пролиферирующими В-клетками и макрофагами.Зародышевый центр окружен плотно упакованными маленькими Т-лимфоцитами, которые реплицируются с меньшей скоростью. Как В-, так и Т-клетки функционируют в распознавании и ответе на антигенную стимуляцию. В-клетки являются основными эффекторными клетками гуморального плеча иммунной системы, тогда как Т-клетки являются основными эффекторными клетками клеточного плеча иммунной системы. Макрофаги и клетки ретикулоэндотелиальной системы также являются частью иммунологической системы, но функционируют в фагоцитозе клеточного мусора или чужеродных веществ, таких как вирусы и бактерии, которые получили доступ к узлу из дренируемой области.Ретикулоэндотелиальная система также выводит из кровообращения некоторые избыточные метаболиты.

Увеличение лимфатических узлов, локализованное или генерализованное, может быть следствием нескольких различных патологических механизмов. Лимфаденопатия может представлять собой увеличение количества и размера лимфоидных фолликулов с пролиферацией лимфоцитов в ответ на новый антиген. Может быть увеличение лимфатических узлов с инфильтрацией узла клетками, которых в норме нет, такими как метастатическая опухоль или лейкемические клетки.Лимфаденопатия может возникать вторично по отношению к неизвестным стимулам, которые заставляют нормальные клетки трансформироваться в клетки лимфомы и разрастаться автономно. Лимфатические узлы могут быть инфильтрированы полиморфно-ядерными клетками, состояние, называемое лимфаденитом , или лимфатические узлы могут быть инфильтрированы макрофагами, загруженными метаболитами, как при заболеваниях накопления липидов.

Клиническая значимость

Учитывая механизмы увеличения лимфатических узлов, ясно, что дифференциальный диагноз лимфаденопатии включает инфекционные процессы, иммунологические состояния, злокачественные процессы, болезни накопления и множество различных расстройств ().

Информация из истории болезни неоценима при диагностическом ведении пациента с лимфаденопатией и часто приводит к точному диагнозу без необходимости обширного диагностического тестирования. Возраст пациента очень важен. Резкое увеличение лимфатических узлов и другой лимфоидной ткани, такой как аденоиды и миндалины, часто является нормальной реакцией на различные относительно слабые антигенные стимулы, такие как легкие вирусные и бактериальные инфекции или вакцинация у младенцев и детей, тогда как у взрослых эти антигены не вызывают обобщенный ответ.Эта разница в возрасте в выражении лимфаденопатии настолько важна, что требует практически совершенно другого диагностического подхода к пациентам до и после полового созревания.

Следует направлять специальные запросы о лекарствах, аллергиях, контактах с животными, хобби и занятиях. Лимфаденопатия как нежелательный ответ на лекарственные препараты и аллергия хорошо известна. Контакт с кошками может вызвать вопрос о лихорадке кошачьих царапин у пациента с односторонней лимфаденопатией конечности.Увеличенные безболезненные лимфатические узлы в эпитрохлеарной, подмышечной, бедренной и паховой областях часто наблюдаются у пациентов, у которых возникают повторяющиеся, обычно незначительные, травмы конечностей. Генерализованная лимфаденопатия также может возникать у пациентов с такими хроническими дерматологическими заболеваниями, как экзема. При подозрении на синдром приобретенного иммунодефицита (СПИД) необходимо получить информацию о потенциальных факторах риска для этого расстройства: сексуальные предпочтения, контакт с людьми, страдающими этим заболеванием, переливание продуктов крови и т. Д.

Также необходимо получить информацию о самой лимфаденопатии. Нежные болезненные узлы, которые появляются и увеличиваются в течение от нескольких дней до нескольких недель, чаще всего являются вторичными по отношению к воспалительному процессу в области, дренируемой лимфатическими узлами. Иногда у пациента с болезненной, быстро увеличивающейся лимфаденопатией развивается лимфома или лейкемия. Однако медленно растущие безболезненные узлы могут указывать на местное или генерализованное злокачественное новообразование.

Необходимо тщательно собрать анамнез в отношении конституциональных симптомов, включая лихорадку, ночную потливость, потерю веса, зуд и общее недомогание.Эти симптомы могут быть связаны либо со злокачественными новообразованиями, либо с инфекционными процессами, такими как туберкулез или гепатит.

Конкретные симптомы, такие как кашель, могут вызывать вопрос о туберкулезе или грибковой легочной инфекции; Желтуха или стул цвета глины в анамнезе должны поднять вопрос о гепатите. Обычно любой диагноз или состояние, предложенные в анамнезе, требуют подтверждения данными физикального обследования и соответствующих лабораторных тестов или биопсии лимфатических узлов. Инфекционные процессы могут быть локализованными, как при локальном абсцессе, так и при целлюлите.Когда инфекция носит системный характер, лимфаденопатия также обычно носит генерализованный характер, как при туберкулезе, бруцеллезе, инфекционном мононуклеозе, гепатите, грибковых инфекциях и токсоплазмозе.

Иммунологические состояния, вызывающие лимфаденопатию, могут быть вторичными по отношению к четко идентифицированным антигенам, например, при сывороточной болезни или реакции на укус насекомого, или лимфаденопатия может быть вторичной по отношению к антигенной стимуляции в условиях, когда антиген не был идентифицирован. Примеры последних включают нарушения соединительной ткани, включая ревматоидный артрит и системную красную волчанку.Саркоидоз – еще один пример иммунологического процесса, который вызывает широко распространенную лимфаденопатию, хотя причинный антиген еще не идентифицирован.

Недавно признанная вирусная (ВИЧ) причина лимфаденопатии – системная инфекция, вызывающая серьезные иммунологические нарушения у хозяина. Этот синдром получил название комплекса СПИДа. Необъяснимая генерализованная аденопатия должна повышать вероятность СПИДа или связанного со СПИДом комплекса, и человека следует тщательно обследовать на предмет возможных факторов риска.Также необходимо получить образцы крови на титры вирусов.

Инвазия злокачественных клеток может вызвать либо регионарную лимфаденопатию, как у пациентов с опухолями головы и шеи, либо генерализованную лимфаденопатию, как у пациентов с диссеминированным карциноматозом. Лимфома также может приводить к регионарной или генерализованной лимфаденопатии.

Общая лимфаденопатия также может быть результатом множества других состояний, включая болезнь Гоше, болезнь Грейвса и болезнь Аддисона.

У большинства пациентов с лимфаденопатией диагноз может быть поставлен после тщательного сбора анамнеза, физического осмотра и соответствующего тестирования, включая гематологические параметры, серологические тесты, кожные пробы и обычные рентгеновские снимки. Как и во всех диагностических исследованиях, эти тесты должны выполняться целенаправленно, чтобы оценить конкретные гипотезы. Если конкретный диагноз не может быть установлен после соответствующей оценки, но есть подозрение на инфекцию, может потребоваться осторожное наблюдение после получения соответствующих культур.Не следует поощрять неизбирательное применение антибиотиков при необоснованных инфекциях. С другой стороны, если диагноз не может быть установлен и злокачественное новообразование является серьезной проблемой, уместна биопсия лимфатического узла, и ее следует проводить своевременно. После проведения биопсии необходимо получить адекватную ткань как для гистологического исследования, так и для соответствующих культур. Иногда для постановки правильного диагноза может потребоваться биопсия более чем одного узла. Иногда в узлах выявляется только неспецифическая лимфоидная гиперплазия, тогда как в соседнем узле может быть метастатическая опухоль.При получении неадекватного образца злокачественное заболевание не может быть диагностировано.

В заключение, хотя дифференциальный диагноз лимфаденопатии может быть широким и иногда изначально сбивающим с толку, тщательный сбор данных из анамнеза, физических и соответствующих лабораторных анализов поможет решить эту проблему у подавляющего большинства пациентов.

Каталожные номера

  1. Doberneck RC. Диагностическая ценность биопсии лимфатических узлов. Arch Surg. 1983; 118: 1203–5. [PubMed: 6412660]
  2. Харви А.М., Бордли Дж.Дифференциальная диагностика. Филадельфия: W.B. Сондерс. 1972: 361–64.

  3. Nieuwenhuis P, Opsteltew D. Функциональная анатомия зародышевых центров. Am J Anat. 1984; 170: 421–35. [PubMed: 6383007]
  4. Сольницкий О.К., Йегерс Х. Лимфаденопатия и нарушения лимфатической системы. В: MacBryde CM. Blacklow RS. Признаки и симптомы: прикладная патологическая физиология и клиническая интерпретация. 5-е изд. Филадельфия: Дж. Б. Липпинкотт, 1970; 476–538.

  5. Zuelzer WW, Kaplan J.Ребенок с лимфаденопатией. Semin Hematol. 1975; 12: 323. [PubMed: 1056101]

Моноцитоидные B-клетки отличаются от клеток маргинальной зоны селезенки и обычно происходят из немутантных наивных B-клеток и реже из B-клеток пост зародышевого центра посредством поликлональной трансформации

https://doi.org/10.1182/blood. V94.8.2800.420a01_2800_2808Get rights and content

Моноцитоидные B-клетки представляют собой морфологически заметную популяцию B-клеток, которая постоянно встречается при лимфаденопатии Пирингера, вызванной Toxoplasma gondii.Хотя широко считается, что они тесно связаны с В-клетками маргинальной зоны селезенки, ни эта взаимосвязь, ни стадия дифференцировки В-клеток моноцитоидных В-клеток, ни их клеточные предшественники не установлены. Поэтому мы исследовали моноцитоидные B-клетки на предмет их экспрессии маркеров дифференцировки B-клеток и изотипов Ig на уровне РНК и белка, а также на наличие перестроенных генов тяжелой цепи (H) Ig и соматических мутаций в вариабельной (V) области. Полученные результаты сравнивали с соответствующими характеристиками других популяций В-клеток.Моноцитоидные В-клетки демонстрировали иммунофенотипические отличия от всех других популяций В-клеток. Экспрессия IgM и IgD отсутствовала в большинстве моноцитоидных В-клеток на уровне РНК и белка. Неродственные (поликлональные) перестройки Ig были обнаружены в 85 из 95 исследованных клеток. Семьдесят четыре процента реаранжированных генов VH были лишены соматических мутаций, тогда как оставшиеся 26% несли небольшое количество соматических мутаций. Большинство из них не показало значимых признаков отбора антигена. Это открытие в сочетании с преимущественно неродственными перестройками генов Ig указывает на то, что большинство моноцитоидных В-клеток возникают не в результате клональной пролиферации, а в результате трансформации поликлональных В-клеток.B-клетки, претерпевающие моноцитоидную B-клеточную трансформацию, в большинстве (74%) являются наивными B-клетками, и только меньшая часть (26%) не являются антиген-отобранными B-клетками пост зародышевого центра. Таким образом, наши данные показывают, что моноцитоидные В-клетки представляют собой отдельную субпопуляцию В-клеток.

Рекомендуемые статьи Цитирующие статьи (0)

Авторские права © 1999 Copyright © 1999 Американское гематологическое общество

Рекомендуемые статьи

Цитирующие статьи

Дисфункция иммунной системы и аутоиммунное заболевание у мышей, лишенных протеинкиназы Emk (Par-1)

Emk представляет собой серин / треониновую протеинкиназу с консервативными гомологами у дрожжей, червей, мух и людей.Мышь Emk была первоначально клонирована с помощью ПЦР с использованием вырожденных праймеров, предназначенных для выделения новых протеинкиназ (10). Emk и родственные члены семейства характеризуются наличием консервативного аминоконцевого домена киназы, за которым следует дивергентная область с неизвестной функцией и заканчивающаяся консервативной областью примерно из 100 аминокислот, которая заканчивается последовательностью глутамат-лейцин-лизин / аспарагин-лейцин. Этот регион был назван доменом ELKL, а мышиный Emk получил свое название от киназы мотива ELKL (10).Emk также был назван MARK2 (для киназы 2, регулирующей сродство микротрубочек) (7) и mPar-1 на основании гомологии с протеинкиназой Par-1 Caenorhabditis elegans (4, 9). У млекопитающих есть две дополнительные родственные Emk протеинкиназы, MARK1 и kp78 / C-TAK1 / MARK3 (7, 19, 21). PAR-1 у обоих C. elegans и Drosophila melanogaster важен для клеточной полярности. У C. elegans PAR-1 необходим для формирования передне-задней (A / P) оси у одноклеточного эмбриона после оплодотворения (11).Белок PAR-1 локализуется в задней части коры одноклеточного эмбриона и сегрегируется в меньшую заднюю клетку P1 после первого деления клетки у C. elegans , что является асимметричным (9). Мутации в par-1 нарушают положение митотического веретена, приводя к симметричному первому делению и неправильной сегрегации детерминант вдоль оси A / P. Недавно сообщалось, что гомолог PAR-1 Drosophila играет важную роль в поляризации A / P у мух (22, 25).У обоих C. elegans и Drosophila белок PAR-1 локализуется в заднем полюсе во время спецификации оси A / P. Как и в случае C. elegans , мутации в Drosophila par-1 нарушают поляризованную организацию цитоскелета микротрубочек ооцита и блокируют локализацию определенных задних детерминант, что приводит к дефектам как в формировании заднего паттерна эмбриона, так и в формировании стволовые клетки. Помимо своей роли в регуляции цитоскелета микротрубочек в ооците, Drosophila par-1 необходим и на других стадиях развития (22).Интересно, что киназа локализуется на базолатеральных мембранах зрелого фолликулярного эпителия, возможно, предполагая роль в поляризации эпителиальных клеток (22). Физиологические функции семейства протеинкиназ EMK / PAR / MARK менее ясны в системах млекопитающих. Гомолог Emk (MARK2) крысы и родственный член семейства MARK1 были клонированы в процессе очистки протеинкиназ в экстрактах мозга, которые фосфорилируют связанные с микротрубочками белки Tau, MAP2 и MAP4 in vitro. Фосфорилирование этих белков снижает их сродство связывания с микротрубочками, что приводит к дестабилизации микротрубочек (7).Кроме того, Emk локализован на базолатеральной мембране культивируемых эпителиальных клеток кишечника, а экспрессия доминантно-отрицательной версии Emk вызывает потерю полярности (4). Взятые вместе, эти данные предполагают, что Emk может участвовать в регуляции и / или поддержании полярности клеток млекопитающих и что эта функция может быть облегчена посредством взаимодействия с цитоскелетом микротрубочек. Третий член этого семейства протеинкиназ, C-TAK1 / kp78 / MARK3, фосфорилирует протеинфосфатазу Cdc25C человека (15, 21).Cdc25C способствует вхождению в митоз путем дефосфорилирования и активации протеинкиназы Cdc2. Фосфорилирование Cdc25C с помощью C-TAK1 происходит по серину 216 и способствует связыванию белков 14-3-3 с Cdc25C (21). Связывание белков 14-3-3 негативно регулирует функцию Cdc25C, предотвращая его накопление в ядре. Исследования РНК-интерференции C. elegans гомолога Cdc25, CDC25.1, продемонстрировали, что белок CDC25.1 необходим для правильного позиционирования борозды митотического расщепления (2).Интересно, что потеря функции CDC25.1 у многих эмбрионов вызывает симметричное первое деление, подобное тому, которое наблюдается у мутантов par-1 .

В этом исследовании мышей, лишенных протеинкиназы Emk, были созданы для выяснения вклада Emk в развивающихся и взрослых мышей. У обоих C. elegans и Drosophila потеря гомолога Emk , par-1 , приводит к гибели эмбриона. Напротив, мыши, лишенные Emk , были жизнеспособными, но демонстрировали эмбриональную и постнатальную задержку роста.Кроме того, у этих мышей обнаружен ряд иммунологических и анатомических дефектов, которые, вместе взятые, согласуются с дефектом гомеостаза иммунной системы у мышей.

МАТЕРИАЛЫ И МЕТОДЫ

Построение вектора наведения Emk.

Геномные клоны Emk размером 9,3 и 6,7 т.п.н. были выделены из геномной библиотеки эмбриональных стволовых (ES) клеток мыши 129 / SvJ (BAC-4921; Genome Systems, Сент-Луис, Миссури) путем гибридизации с изогенным 1-т.п.н. Emk -специфический кДНК-зонд.Карты рестрикционных ферментов локуса Emk были определены с использованием бактериальных искусственных хромосомных клонов и геномной ДНК из клеток NIH 3T3 L1. Геномные клоны содержали перекрывающиеся последовательности, включая 1,9 т.п.н. 5′-интронной последовательности перед первым идентифицированным экзоном (соответствует нуклеотидам с 55 по 234, кодирующим аминокислоты с 19 по 78). Ни один из клонов не содержал 5′-крайнего экзона (ов) гена Emk . Мы обозначили первый экзон, содержащийся в геномных клонах, как экзон 2, хотя 54 нуклеотида, кодирующие первые 18 аминокислот Emk, могут содержаться более чем в одном экзоне.Геномная организация мышиного гена Emk была нарушена заменой части экзона 2 и всех экзонов 3 и 4 гена Emk кассетой pTK-neo, полученной из pSSC9 (5). Кассета содержит кДНК неомицинфосфотрансферазы в качестве селектируемого маркера, фланкированного 5′-промотором тимидинкиназы и 3′-последовательностью полиаденилирования тимидинкиназы.

Гомологичная рекомбинация и образование химер зародышевой линии.

RW4 ES-клетки (онкологический центр Siteman при Школе медицины Вашингтонского университета) электропорировали с помощью линеаризованного вектора нацеливания и отбирали с помощью Geneticin (G418; Gibco) (подробные процедуры см. На сайте: http: // медицина.wustl.edu/∼escore). Всего 126 G418-устойчивых ES-колоний были проанализированы на гомологичную рекомбинацию методом Саузерн-блоттинга с использованием зонда, созданного с помощью ПЦР на 500 пар оснований, соответствующего фрагменту геномной ДНК Bam HI- Xba I на 5′-конце 9,3- геномный клон kb, описанный выше. Пять клонов ES, гетерозиготных по Emk , инъецировали в бластоцисты C57BL / 6, которые впоследствии имплантировали в матки приемных матерей псевдобеременных B6C3F1. Мужские химеры из трех клонов, отобранных по окраске агути, скрещивали с самками C57BL / 6.Передача по зародышевой линии была получена для всех трех клонов. F 1 животных тестировали на целевой аллель Emk с помощью саузерн-блоттинга и ПЦР-анализа хвостовой ДНК, используя трехпраймерную ПЦР с 5′-праймером из экзона 2 (5’AGCCACCTCTGCTGACGAGCAGCC), 3′-праймером из интронная последовательность между экзонами 2 и 3 (3′GCACCAAGTCCTGGTTCAGTCTGC) и 3 ′ праймер из кассеты неомицина (3 ′ CCTGATGCTCTTCGTCCAGATCAT). Гетерозиготных самцов F 1 и самок скрестили с получением однопометных потомков F 2 .

Генерация MEF.

Эмбриональные фибробласты мыши (MEF) были получены из 13,5-дневных эмбрионов. После удаления головы и внутренних органов эмбрионы промывали фосфатно-солевым буфером (PBS), измельчали ​​и расщепляли 1 мл трипсин-ЭДТА (0,5% трипсин, 0,53 мМ ЭДТА) на эмбрион в течение 20 минут при 37 ° C. . Трипсин был инактивирован добавлением минимальной необходимой среды Дульбекко, содержащей 10% фетальной бычьей сыворотки, 2 мМ l-глутамина, 0,1 мМ заменимых аминокислот, 100 мкМ 2-меркаптоэтанола, 100 Ед пенициллина G на мл и 100 мкг стрептомицина на мл. .Клетки от одиночных эмбрионов помещали в одну чашку для тканевых культур диаметром 60 мм и инкубировали при 37 ° C в увлажненной камере с 10% CO 2 . Клетки обрабатывали трипсином и заменяли каждые 2 дня. Каждая трипсинизация и повторная репликация представляли собой один отрывок. Перед кризисом клетки анализировали на экспрессию Emk.

Анализ белка Emk.

Всего 2 × 10 6 MEF были собраны из культуры ткани p60 путем триспсинизации. Клетки один раз промывали PBS и лизировали в 300 мкл буфера для лизиса клеток млекопитающих (50 мМ Трис [pH 8.0], 100 мМ NaCl, 2 мМ дитиотреитол [DTT], 5 мМ ЭДТА, 0,5% NP-40, 1 мкМ микроцистина, 1 мМ ортованадат натрия, 2 мМ фенилметилсульфонилфторид, 0,15 Ед апротинина на мл, 20 мкМ лейпептина, 20 мкМ пепстатина) при 4 ° C в течение 20 мин. Различные ткани мыши гомогенизировали в буфере для лизиса клеток млекопитающих с использованием гомогенизатора Fisher Scientific Powergen 700, снабженного пилообразным генератором. После гомогенизации ткани селезенки эритроциты удаляли центрифугированием в градиенте плотности с использованием Histopaque-1119 (Sigma Chemical Co.). Лизаты из MEF и целых органов осветляли центрифугированием, и концентрации белка определяли с помощью набора для анализа белков Bio-Rad. Для анализа вестерн-блоттингом 250 мкг общих клеточных или тканевых белков разделяли электрофорезом в полиакриламидном геле с додецилсульфатом натрия (SDS-PAGE) (7% полиакриламид). Вестерн-блоттинг выполняли с использованием разведения 1: 500 аффинно очищенного кроличьего поликлонального антитела Emk (100 мкг / мл), созданного против продуцируемого бактериями гибридного белка EMK человека с глутатион- S -трансферазой (GST-hEMK).Вторичный крысиный антикроличий иммуноглобулин G (IgG) – антитела, конъюгированные с пероксидазой хрена (Zymed), использовали в разведении 1: 2000. Для хемилюминографии на пленке Kodak (Рочестер, Нью-Йорк) X-OMAT AR использовали набор для детектирования усиленной хемилюминесценции Amersham.

Анализ киназ иммунных комплексов.

Порцию общего тканевого белка в 1 мг инкубировали с 20 мкл аффинно очищенного Emk-специфического антитела (100 мкг / мл) в объеме 550 мкл в течение 2 часов при 4 ° C с последующим дополнительным часом при 4 ° C. C с 80 мкл 50% суспензии шариков сефарозы CL-4B – протеин А.Гранулы трижды промывали буфером для лизиса клеток млекопитающих и один раз – неполным буфером киназы (50 мМ Трис-HCl [pH 7,5], 12,5 мМ MgCl 2 , 1 мМ DTT), а затем инкубировали с 1,2 мкг рекомбинантного GST-Cdc25C ( 200–256) белка (20) при 30 ° C в течение 10 мин в 40 мкл полного киназного буфера (50 мМ Tris HCl [pH 7,5], 12,5 мМ MgCl 2 , 1 мМ DTT, 50 мкМ АТФ и 2 мкКи [γ- 32 P] АТФ [> 4000 Ки / ммоль]). Реакционные смеси доводили до 100 мМ EDTA перед кипячением в буфере для образцов SDS-PAGE.Образцы разделяли на SDS – 12% полиакриламидном геле, и белки визуализировали окрашиванием кумасси синим и авторадиографией. 32 Включение P в мотив GST-Cdc25C определяли путем вырезания радиоактивно меченных белков с последующим подсчетом на многоцелевом сцинтилляционном счетчике Beckman 6500.

Нозерн-блоттинг.

Нозерн-блоты множественных тканей человека и мыши (Clontech) зондировали на наличие мРНК Emk , как указано производителем. Зонд, использованный для скрининга тканей мыши, представлял собой продукт ПЦР размером 480 п.о. (от 1245 до 1725 п.о. мышиного Emk), созданный с праймерами 5 ‘CCACCTCGAATTCCTACTCTAA и 3’ CTCCACTACTGCTGCTGATGTT.Зонд, используемый для скрининга тканей человека, представлял собой рестрикционный фрагмент Eco RI длиной 855 п.о. человеческого EMK (п.о. 495-1350). Зонды метили [α- 32 P] dCTP (NEN) с использованием системы мечения ДНК Megaprime (Amersham) при 10 9 имп / мин / мг. Нозерн-блот для нескольких тканей предварительно гибридизовали с раствором ExpressHyb (Clontech) в течение 1 ч при 68 ° C при встряхивании. Меченый зонд Emk добавляли к 2 × 10 6 имп / мин / мл, и блот гибридизовали в растворе ExpressHyb в течение 1 ч при 68 ° C.Затем блот трижды промывали в течение 30 мин при комнатной температуре в 2X SSC (1X SSC – 0,15 M NaCl плюс 0,015 M цитрат натрия) –0,05% SDS. Блот трижды промывали 0,1X SSC – 0,1% SDS в течение 40 мин при встряхивании при 50 ° C. Нижнюю половину Нозерн-блотов множественных тканей как человека, так и мыши зондировали на человеческий β-актин с использованием зонда, приготовленного, как описано выше.

Гистология, иммунофлуоресценция и электронная микроскопия.

Для гистологических исследований ткани фиксировали в 10% нейтральном забуференном формалине, промывали PBS и хранили в 70% этаноле.Фиксированные ткани залили парафином по стандартным методикам. Блоки были разделены (5 мкм) и окрашены гематоксилином и эозином. Для электронной микроскопии свежие образцы почек были разделены на блоки размером 1 мм, зафиксированы 2% глутаровым альдегидом в PBS и залиты эпоксидной смолой. Тонкие срезы окрашивали уранилацетатом, а затем выполняли электронную микроскопию в Исследовательском центре гистологии Департамента патологии Вашингтонского университета.

Иммунофлуоресценция использовалась для обнаружения и локализации отложений IgG и C3 в почечной паренхиме.Свежие почки устанавливали в Tissue Tek O.C.T. соединение (Sakura Finetek, Inc.), мгновенно замораживали на сухом льду и хранили при -70 ° C. Срезы криостата (5 мкм) вырезали и фиксировали в ацетоне в течение 20 мин. Срезы промывали PBS три раза по 5 минут каждый, а затем предварительно инкубировали либо с 5% нормальной сывороткой осла (для окрашивания IgG), либо с 5% нормальной сывороткой козла (для окрашивания C3) в PBS в течение 30 минут. Их окрашивали в течение 1 ч при комнатной температуре разбавлением 1: 100 ослиного антимышиного IgG, конъюгированного с Cy3 (Jackson Immunoresearch), и / или разведением 1: 100 козьего антимышиного C3, конъюгированного с флуоресцеином (Cappel).Их снова трижды промывали PBS по 5 мин для каждого. Образцы анализировали под микроскопом Olympus BX60.

Проточная цитометрия.

Ткани селезенки, лимфатического узла и тимуса гомогенизировали в среде K5 (RPMI 1640, содержащий 10% фетальной бычьей сыворотки, 15 мМ HEPES, 10 мкМ заменимых аминокислот, 1 мМ пируват натрия, 2 мМ l-глутамин, 50 нМ 2- меркаптоэтанол, 100 Ед пенициллина / мл и 100 мкг стрептомицина / мл) с использованием проволочной сетки. Суспензии клеток осаждали, дважды промывали средой K5 и подсчитывали с помощью гемацитометра.Их смешивали с различными моноклональными антителами (MAb), конъюгированными либо с флуоресцеинизотиоцианатом (FITC), либо с фикоэритрином (PE). Антитела от PharMingen включали FITC- и PE-конъюгированные анти-CD4, PE-конъюгированные анти-CD8, FITC- и PE-конъюгированные анти-CD45R / B220, PE-конъюгированные анти-CD44 (Pgp-1), PE-конъюгированные анти- CD62L / MEL-14, PE-конъюгированные анти-CD69, PE-конъюгированные анти-NK1.1, PE- и FITC-конъюгированные анти-CD24 / HSA, FITC- и PE-конъюгированные анти-IgM, FITC-анти-IgD, PE-конъюгированные анти-CD5, FITC-конъюгированные анти-CD90.2 / Thy-1.2, FITC-конъюгированные анти-CD11b / MAC-1, FITC-конъюгированные анти-MAC-3, FITC-конъюгированные анти-CD3, PE-конъюгированные анти-CD25 / IL-2Rβ, PE-конъюгированные анти-Ly -6G / Gr-1, PE-конъюгированные анти-CD138, PE-конъюгированные анти-Ter119 и PE-конъюгированные анти-CD19. Все антитела использовали в количестве 1 мкг / 10 6 клеток после блокирования неспецифического связывания Fc смесью антител против CD16 / CD32 (PharMingen). Анализы выполняли на приборе Becton Dickinson FACSCalibur, оснащенном программным обеспечением CellQuest.

Очистка популяций В- и Т-клеток.

CD4 + T-клетки и B220 + B-клетки были очищены из неочищенных препаратов спленоцитов путем удаления красных кровяных телец центрифугированием в чистом градиенте с использованием Histopaque-1119 с последующим окрашиванием PE-конъюгированным анти-CD4 MAb или PE-конъюгированным анти-антителом. -B220 / CD45R MAb в количестве 1 мкг / 10 6 клеток. Затем В-клетки B220 + и Т-клетки CD4 + были отсортированы с использованием сортировщика клеток Cytomation MoFlo до чистоты> 95%.

Определение продукции IFN-γ и IL-4 активированными CD4

+ Т-клетками. Для анализа цитокинов CD4 + Т-клетки, полученные от двух или трех мышей, выращивали на связанных с планшетом анти-CD3 MAb (5 мкг / мл) и анти-CD28 MAb (5 мкг / мл; PharMingen) в течение 3 дней ниже один из трех наборов условий, указанных в подписях к рисункам. Всего 2,5 × 10 5 клеток высевали в каждую лунку 48-луночного планшета в условиях развития Th2, содержащих мышиный рекомбинантный интерлейкин-12 (rIL-12) (10 Ед / мл) (Genetics Institute) и анти-IL. -4 MAb (10 мкг / мл) (11B11) (16), в условиях развития Th3, содержащих мышиный rIL-4 (100 Ед / мл) (из супернатанта трансфицированных клеток мастоцитомы P815) и MAb против IL-12 (3 мкг / мл). ml) (антитело Tosh) (26) или в нейтрализующих условиях, содержащих анти-IL-12 и анти-IL-4 MAb.Через 3 дня клетки подсчитывали, повторно помещали в колбы T175 в присутствии человеческого rIL-2 (200 Ед / мл) (Takeda Chemical Industries, Inc.) и размножали еще в течение четырех дней. Наконец, на 7 день 2,5 × 10 5 клеток рестимулировали либо анти-CD3 MAb (5 мкг / мл), либо форболмиристатацетатом (PMA) (50 нг / мл) и иономицином (1 мкМ) или конканавалином A ( Sigma Chemical Co.) в течение 48 ч в 96-луночных планшетах. Затем культуральные супернатанты использовали для гамма-интерферона (IFN-γ) и иммуноферментных анализов IL-4 (ELISA).

Анализы пролиферации.

Анализы пролиферации проводили с неочищенными спленоцитами или с очищенными популяциями CD4 + T-клеток и B220 + B-клеток. Всего 2 × 10 5 клеток высевали в каждую лунку 96-луночной чашки для культуры ткани Costar и инкубировали в течение указанного времени. Митогены B-клеток включали козий антимышиный IgM F (ab ‘) 2 (Jackson ImmunoResearch), использованный в конечной концентрации 20 мкг / мл, антимышиный CD40 (PharMingen) (конечная концентрация 1 мкг / мл) и ПМА-иономицин (конечная концентрация 100 нг / мл и 1 мкМ соответственно), если не указано иное.Липополисахарид и конканавалин А (Sigma Chemical Co.) использовали в анализах пролиферации в концентрациях 50 и 5 мкг / мл соответственно, если не указано иное. Все эксперименты проводили в трех повторностях. Клетки инкубировали с 2 мкКи [ 3 H] тимидина на лунку (конечная концентрация 10 мкКи / мл) в течение последних 8 часов культивирования. Их собирали с использованием Skatron Instruments Micro96Harvester и подсчитывали с помощью многоцелевого сцинтилляционного счетчика Beckman 6500.

Гуморальные иммунные ответы.

Ретроорбитальные кровотечения были получены от однопометников дикого типа и Emk – / – перед инъекцией либо Т-клеточно-зависимого антигена 4-гидрокси-3-нитрофенилацетил-гемоциарина лимфы улитки (NP-KLH) ( Biosearch Tech., Inc.) или независимый от Т-клеток антиген NP-Ficoll (Biosearch Tech., Inc.). Мышам внутрибрюшинно вводили либо 10 мкг NP-KLH, либо 20 мкг NP-фиколла. Для NP-KLH второе кровотечение производили на 10-й день после инъекции, а вторую инъекцию делали на 14-й день.Третью кровь брали у мышей, которым инъецировали NP-KLH, через 7 дней после второй инъекции (21 день после первоначальной инъекции). Для NP-фиколла второе кровотечение производили на 7-й день после первой инъекции, а затем – вторую инъекцию на 10-й день. Третье кровотечение производили через 7 дней после второй инъекции (17 дней после первоначальной инъекции). Титры NP-специфических антител в образцах сыворотки определяли с помощью ELISA. Планшеты Immulon 4 HBX (96 лунок) (Dynex Tech., Inc.) покрывали 1 мкг NP-бычьего сывороточного альбумина (Biosearch Tech., Inc.) на мл. Образцы сыворотки связывали с планшетами в серии разведений от 1:50 до 1: 3 × 10 6 . Затем NP-специфические антитела были связаны с биотин-конъюгированными козьими антителами против изотипа мышиного Ig (анти-IgM, анти-IgG1, анти-IgG2a и анти-IgG3) от CalTag, Inc. Затем для лечения использовали пероксидазу хрена, конъюгированную со стрептавидином. обнаружение биотин-Ig с субстратом 2,2′-азино-ди (3-этилбензтиазолинсульфонат) (ABTS). Титры Ig от отдельных мышей получали путем определения разведения, при котором образцы сыворотки давали показания оптической плотности при 414 нм, равные 0.2 на фоне. Статистическая значимость различий рассчитывалась с использованием логарифмических значений титров в тесте Стьюдента t . Уровни NP-специфического IgG не были значимыми до инъекции (день 0).

ОБСУЖДЕНИЕ

Это исследование описывает сложные иммунологические фенотипы, которые возникают у мышей, лишенных протеинкиназы Emk. Хотя развитие В- и Т-клеток было нормальным у мышей Emk, – / – , CD4 + Т-клетки, полученные из селезенки и лимфатических узлов 8-недельных нулевых животных, экспрессировали повышенные уровни памяти на клеточной поверхности. маркер CD44 / pgp-1.Кроме того, перекрестное связывание TCR на нулевых CD4 + Т-клетках селезенки для Emk продуцировало более высокие уровни IFN-γ и IL-4, чем перекрестное связывание TCR на CD4 + Т-клетках, полученных из однопометники дикого типа. Таким образом, CD4 + Т-клетки, лишенные протеинкиназы Emk, проявляли свойства, соответствующие свойствам ранее активированных Т-клеток, подобных памяти. В соответствии с этими открытиями мыши Emk, – / – также проявляли усиленный ответ после заражения Т-клеточно-зависимым антигеном NP-KLH.Повышенные уровни IgG1 и IgG2a, продуцируемые у мышей Emk – / – после заражения in vivo, могут быть связаны с усилением помощи, оказываемой Emk – / – CD4 + Т-лимфоцитами после переключения изотипа В-клеток на IgG1 и IgG2a являются процессами, управляемыми IL-4 и IFN-γ, соответственно (18).

Молекулярный путь, по которому отсутствие Emk приводит к повышенным уровням CD4 + Т-клеток с фенотипом, типичным для клеток памяти или активированных клеток у нулевых животных, неизвестен.Emk экспрессируется как в Т-клетках тимуса, так и в селезенке. Одна возможность состоит в том, что Emk требуется для поддержания CD4 + Т-клеток в наивном состоянии, и что потеря Emk приводит к несоответствующей активации этих клеток. В отсутствие Emk CD4 + Т-клетки могут отвечать на собственные антигены или антигены окружающей среды. Поскольку апоптотическая гибель клеток является важным механизмом для поддержания самотолерантности и гомеостаза в иммунной системе, мы выполнили анализы индуцированной антигеном гибели клеток. Было обнаружено, что индуцированная активацией гибель клеток эквивалентна Emk + / + и Emk – / – Т-клеткам, что указывает на то, что путь регуляции апоптоза был интактным в отсутствие Emk (данные не показаны) .В дополнение к изменениям функции Т-клеток, описанным выше, мы наблюдали различия в ответе В-клеток на активацию после перекрестного связывания IgM. Пролиферативный ответ B220 + Emk – / – спленоцитов был нормальным в ответ на лечение PMA-иономицином и анти-CD40, но был снижен на ∼60% по сравнению с Emk + / + на IgM сшивание in vitro. Обнаружение того, что обработка сложным эфиром форбола иономицином вызывает нормальный пролиферативный ответ, предполагает, что передача сигналов ниже протеинкиназы C не нарушена в B-клетках, лишенных Emk .

По мере старения мышей Emk – / – наблюдался ряд дополнительных фенотипов. В возрасте примерно 6 месяцев лимфоцитарные инфильтраты наблюдались в легких, почках и слюнных железах у мышей Emk – / – . Большинство лимфоцитарных инфильтратов, обнаруженных в почках и легких, представляют собой клетки B220 + и плазматические клетки. Поверхностные паховые лимфатические узлы как молодых, так и старых мышей Emk – / – были в среднем более клеточными, чем их аналоги дикого типа, и это увеличение было связано с увеличением клеток B220 + .Кроме того, у ~ 30% мышей Emk – / – развилась спленомегалия в возрасте от 6 до 7 месяцев. Популяции B220 + значительно уменьшились в увеличенной селезенке Emk – / – , несмотря на увеличение общего количества ядерных клеток. Одним из возможных объяснений наблюдаемого снижения количества клеток B220 + селезенки может быть исчерпывающая активация и дифференцировка B-клеток Emk – / – в плазматические клетки (которые не экспрессируют B220 на своей клеточной поверхности), поскольку в результате хронической активации Т-клеток.Подобные наблюдения наблюдались у мышей IL-2Rβ – / – , где активация Т-клеток CD4 + предшествует исчезновению клеток B220 + с периферии (24). Резкое увеличение количества спленоцитов, коэкспрессирующих HSA (мышиный CD24) и Ter119 (маркер линии эритроидных клеток), наблюдалось у мышей Emk – / – . Причина повышенного эритропоэза неясна. Интересно, что у мышей с дефицитом как Stat5a , так и Stat5b есть Т-клетки с активированным фенотипом или фенотипом памяти, и с возрастом у этих мышей также развивается спленомегалия, связанная с повышенными уровнями клеток Ter119 + (13).Обнаружение активированных CD4 + Т-клеток и дифференцированных В-клеток у мутантных мышей указывает на риск аутоиммунитета. В подтверждение этого, накопление субэндотелиальных отложений IgG в капиллярных петлях почек наблюдалось у ~ 50% мышей Emk – / – . И электронная микроскопия, и стандартный гистологический анализ также выявили гиперцеллюлярность клубочков из-за пролиферации мезангиальных клеток. В совокупности эти наблюдения показывают, что у мышей Emk, – / – развивается аутоиммунный MPGN.Хотя аутоиммунитет может объяснить фенотипы, наблюдаемые у мышей Emk, – / – , дефекты адгезии и / или хоуминга лимфоцитов могут также объяснить лимфоцитарные инфильтраты, наблюдаемые в почках и легких. Следует также отметить, что это исследование не выявило, являются ли иммунологические дефекты, наблюдаемые у мышей Emk, – / – , клеточно-автономными для лимфоцитов. Трансплантация костного мозга и органов поможет определить, вызваны ли наблюдаемые фенотипы, например, дефектами антигенпрезентирующих клеток или изменениями структурной целостности почек и / или легких.Интересно, что несколько фенотипов, описанных у мышей Emk, – / – , также наблюдались с меньшей частотой и серьезностью у мышей Emk +/- , что позволяет предположить, что гаплонедостаточность киназы Emk также может приводить к иммунной системе. возмущение. Роль протеинкиназ семейства Emk / Par-1 / MARK в регуляции функции иммунных клеток ранее не описывалась. Bessone et al. сгенерировали мышей, лишенных Emk , с использованием метода перехвата генов (3).Они сообщили о задержке роста у мышей Emk – / – и нарушении фертильности у самок Emk – / – . Мы также наблюдали фенотипы задержки роста и гипофертильности у мышей Emk, – / – . Однако исследование Bessone et al. (3) не сообщали об иммунологических нарушениях у мышей Emk – / – . Это неудивительно, отчасти потому, что описанные здесь основные иммунологические нарушения не проявляются до возраста ~ 6 месяцев.Кроме того, несколько мышей умирают от этих заболеваний, и, за исключением выпадения прямой кишки, другие фенотипы не видны, кроме как после гистологического исследования пораженных тканей старых мышей. В C. elegans и D. melanogaster , Гомолог Emk , par-1 , действует на ранней стадии установления эмбриональной полярности (9, 22, 25). Белок ЕМК млекопитающих локализован в латеральном мембранном домене культивируемых эпителиальных клеток, и экспрессия доминантно-отрицательной версии ЕМК нарушает полярность этих клеток, предполагая консервативную функцию этого семейства протеинкиназ на протяжении всей эволюции (4).Однако экспрессия доминантно-отрицательной формы EMK также приводит к гибели клеток, из-за чего из этих исследований неясно, была ли потеря полярности причиной или следствием гибели клеток. Лимфоциты должны поляризоваться, чтобы образовывать межклеточные контакты во время распознавания антигена и для миграции через эндотелиальные клетки к участкам инфекции. Один из способов контролировать поляризацию Т-клеток – это измерить их способность двигаться к хемоаттрактанту in vitro. Чтобы изучить возможный вклад Emk в поляризацию Т-клеток, Emk, – / – Т-клетки отслеживали на предмет их способности двигаться к хемоаттрактанту, фактору 1, происходящему из стромальных клеток.Никаких наблюдаемых различий между Т-клетками Emk + / + и Emk – / – Т-клеток в этом анализе отмечено не было (данные не показаны). Однако эти эксперименты не исключают возможную роль Emk в поляризации, поскольку связанные с EMK члены семейства C-TAK1 / MARK1 или MARK3 могут функционально компенсировать потерю Emk в этих условиях. Таким образом, наши результаты демонстрируют, что нарушение Emk приводит к потере гомеостаза иммунной системы и предполагают роль (и) протеинкиназы Emk в регуляции функций Т- и В-клеток у мышей.

БЛАГОДАРНОСТИ

Мы благодарим E. Unanue за помощь в электронной микроскопии и анализе данных. Благодарим T. McDonnell и M. Zutter за их интерпретацию гистологии тканей. Благодарим О. Канагаву и К. Сабелко за помощь в ранней характеристике фенотипов иммунных клеток. Благодарим M. LaRegina за предоставление услуг по патологии, M. Dustin за помощь в анализе хемотаксиса, а R. Schreiber за помощь в проведении ELISA. А. Шоу, Д. Чаплин, Т.Благодарим Чатиллу, Дж. Аткинсона, Дж. Лонгмора и П. Аллена за ценные обсуждения и вклад. Спасибо T. Ley и сотрудникам отделения трансплантации костного мозга и биологии стволовых клеток Вашингтонского университета за их полезные предложения по фенотипическому анализу. Мы благодарим Центр ES стволовых клеток Siteman Cancer Center в Вашингтонском университете за выполнение электропорации ES-клеток, а также M. White за инъекции бластоцист мышам и создание химерных мышей.

Работа частично поддержана стипендией Дж.H. из фонда Люсиль П. Марки. A.C.C., K.M.M. и H.P.-W. являются следователями Медицинского института Говарда Хьюза.

Хирургия лимфатических узлов при раке груди

Если рак груди распространяется, он обычно сначала поражает близлежащие лимфатические узлы под мышкой. Иногда он также может распространяться на лимфатические узлы около ключицы или около грудины (передний центр грудной клетки). Информация о том, распространился ли рак на ваши лимфатические узлы, помогает врачам найти лучший способ вылечить ваш рак.

Если вам поставили диагноз «рак груди», важно выяснить, как далеко распространился рак. Чтобы определить, распространился ли рак за пределы груди, один или несколько лимфатических узлов под мышкой (подмышечные лимфатические узлы) удаляются и проверяются в лаборатории. Это важная часть постановки. Если в лимфатических узлах есть раковые клетки, высока вероятность того, что раковые клетки также распространились на другие части тела. Если это так, могут быть выполнены дополнительные визуализационные тесты.

Удаление лимфатических узлов может выполняться по-разному, в зависимости от того, увеличены ли какие-либо лимфатические узлы, насколько велика опухоль груди и других факторов.

Биопсия увеличенного лимфатического узла

Если какой-либо из лимфатических узлов под рукой или вокруг ключицы опух, их можно проверить на рак с помощью игольной биопсии, тонкоигольной аспирации (FNA) или стержневой игольной биопсии. Реже увеличенный узел удаляют хирургическим путем. Если рак обнаружен в лимфатическом узле, необходимо удалить больше узлов (см. Ниже).

Виды операций на лимфатических узлах

Даже если соседние лимфатические узлы не увеличены, их все равно нужно проверять на рак. Это можно сделать двумя разными способами. Биопсия сторожевого лимфатического узла (БСЛУ) является наиболее распространенным методом, при котором удаляются только несколько лимфатических узлов. Но в некоторых случаях может потребоваться диссекция подмышечных лимфатических узлов (ALND), которая удаляет больше лимфатических узлов.

Операция на лимфатическом узле часто проводится как часть основной операции по удалению рака груди, но иногда она может проводиться как отдельная операция.

Биопсия сторожевого лимфатического узла

При биопсии сигнального лимфатического узла (SLNB) хирург находит и удаляет первый лимфатический узел (узлы), на который может распространиться рак (так называемые сторожевые узлы ). Радиоактивное вещество и / или синий краситель вводят в опухоль, область вокруг нее или область вокруг соска. Лимфатические сосуды будут переносить эти вещества по тому же пути, по которому, вероятно, пойдет рак. Первый лимфатический узел (узлы), к которому перемещается краситель или радиоактивное вещество, будет сигнальным узлом (узлами).

После того, как вещество было введено, сигнальные узлы можно найти либо с помощью специальной машины для обнаружения радиоактивности в узлах, либо путем поиска узлов, которые стали синими. Иногда используются оба метода. Хирург разрезает кожу над областью лимфатического узла и удаляет узел (ы), содержащий краситель или радиоактивные вещества.

Несколько удаленных лимфатических узлов затем тщательно проверяются патологом в лаборатории на наличие раковых клеток. Иногда это делается во время операции.Поскольку есть вероятность, что другие лимфатические узлы в той же области также будут иметь рак, если рак обнаружен в сторожевых лимфатических узлах, хирург может продолжить подмышечную диссекцию (ALND), чтобы удалить больше лимфатических узлов, пока вы находитесь. все еще на операционном столе. Если раковые клетки не обнаружены в узле (ах) во время операции или если они не проверены патологом во время операции, они будут исследованы более внимательно в течение следующих нескольких дней.

Если позже рак обнаружен в сторожевом узле (ах), хирург может порекомендовать АЛНД позже, чтобы проверить другие узлы на наличие рака.Однако исследования показали, что в некоторых случаях можно безопасно оставить остальные лимфатические узлы. Это основано на определенных факторах, таких как размер опухоли груди, какой тип операции используется для удаления опухоли и какое лечение планируется после операции, среди прочего.

На основании исследований, в которых рассматривалась эта проблема, пропуск ALND Возможен вариант для:

  • Женщинам с опухолями 5 см (2 дюйма) или меньше, у которых не более 2 положительных контрольных лимфатических узлов, которым выполняется операция по сохранению груди с последующей лучевой терапией, и они не получали никакой химиотерапии до операции.
  • Женщины, у которых лимфатические узлы с очень небольшим размером рака (не более 2,0 мм) и которым выполняется мастэктомия.

Если в сигнальном узле (ах) нет рака, очень маловероятно, что рак распространился на другие лимфатические узлы, поэтому дальнейшая операция на лимфатическом узле не требуется.

SLNB часто рассматривается для женщин с раком груди на ранней стадии и обычно не используется для женщин с воспалительным раком груди. В некоторых случаях его можно использовать для женщин с местнораспространенным раком груди, например, после неоадъювантного лечения.

Хотя SLNB стала обычной процедурой, она требует большого мастерства. Это должен делать только хирург, имеющий опыт работы с этой техникой. Если вам предложат этот вид биопсии, спросите своего хирурга, регулярно ли он их делает.

Диссекция подмышечных лимфатических узлов (ALND)

В этой процедуре от 10 до 40 (хотя обычно менее 20) лимфатических узлов удаляются из области под мышкой (подмышечная впадина) и проверяются на предмет распространения рака.ALND обычно выполняется одновременно с мастэктомией или операцией по сохранению груди (BCS), но ее можно провести во время второй операции. ALND может понадобиться:

  • Если предыдущая БСЛУ показала наличие раковых клеток в 3 или более подмышечных лимфатических узлах
  • Если опухшие лимфатические узлы подмышек или ключицы можно прощупать до операции или увидеть при визуализирующих исследованиях, а биопсия с помощью FNA или стержневой иглы показывает рак
  • Если рак стал достаточно большим, чтобы выйти за пределы лимфатического узла (ов)
  • Если SLNB положителен на раковые клетки после химиотерапии для уменьшения опухоли перед операцией

После операции на лимфатическом узле возможны боль, отек, кровотечение, образование тромбов и инфекция.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *